- Clone
- 3G7A02 (See other available formats)
- Regulatory Status
- RUO
- Other Names
- TNFRSF1B, p75, p75TNFR, TNFR2, TNFR80, TBPII
- Isotype
- Rat IgG2a, κ
- Barcode Sequence
- GCGCAACTCCTTGTA
- Ave. Rating
- Submit a Review
- Product Citations
- publications
Cat # | Size | Price | Quantity Check Availability | Save | ||
---|---|---|---|---|---|---|
358419 | 10 µg | $369 |
CD120b, also known as TNFRII or TNFRSF1B, belongs to the TNF receptor superfamily and can interact with ligands TNF-α and TNF-β (also known as LT-α). It is a 75 kD type I transmembrane protein expressed on lymphocytes, monocytes, and granulocytes. When present in a heterocomplex with CD120a, it induces the recruitment of anti-apoptotic molecules, c-IAP1 and c-IAP2 that possess E3 ubiquitin ligase activity. Mutations in CD120b are associated with TNF-associated periodic syndrome (TRAPS) or periodic fever syndrome.
Product DetailsProduct Details
- Verified Reactivity
- Human
- Antibody Type
- Monoclonal
- Host Species
- Rat
- Immunogen
- Partial CD120b recombinant protein expressed in 293E cells (22-211aa).
- Formulation
- Phosphate-buffered solution, pH 7.2, containing 0.09% sodium azide and EDTA
- Preparation
- The antibody was purified by chromatography and conjugated with TotalSeq™-D oligomer under optimal conditions.
- Concentration
- 0.5 mg/mL
- Storage & Handling
- The antibody solution should be stored undiluted between 2°C and 8°C. Do not freeze.
- Application
-
PG - Quality tested
- Recommended Usage
-
Each lot of this antibody is quality control tested by immunofluorescent staining with flow cytometric analysis and the oligomer sequence is confirmed by sequencing. TotalSeq™-D antibodies are compatible with Mission Bio’s Tapestri Single-Cell Sequencing Platform for simultaneous detection of DNA and Protein.
To maximize performance, it is strongly recommended that the reagent be titrated for each application, and that you centrifuge the antibody dilution before adding to the cells at 14,000xg at 2 - 8°C for 10 minutes. Carefully pipette out the liquid avoiding the bottom of the tube and add to the cell suspension. For Proteogenomics analysis, the suggested starting amount of this reagent for titration is ≤ 1.0 µg per million cells in 100 µL volume. Refer to the corresponding TotalSeq™ protocol for specific staining instructions.
Buyer is solely responsible for determining whether Buyer has all intellectual property rights that are necessary for Buyer's intended uses of the BioLegend TotalSeq™ products. For example, for any technology platform Buyer uses with TotalSeq™, it is Buyer's sole responsibility to determine whether it has all necessary third party intellectual property rights to use that platform and TotalSeq™ with that platform. - Additional Product Notes
-
TotalSeq™-D reagents are designed to profile protein expression at single cell level. The Mission Bio Tapestri platform and sequencer (e.g. Illumina analyzers) are required. Please contact technical support for more information, or visit biolegend.com/totalseq/single-cell-dna
The barcode flanking sequences are CGAGATGACTACGCTACTCATGG (PCR handle), and GAGCCGATCTAGTATCTCAGT*C*G (capture sequence). * indicates a phosphorothioated bond, to prevent nuclease degradation.
View more applications data for this product in our Application Technical Notes. - RRID
-
AB_2894614 (BioLegend Cat. No. 358419)
Antigen Details
- Structure
- 75 kD, type I transmembrane protein, member of the TNF-receptor superfamily, forms a heterocomplex with TNFRI
- Distribution
-
Expressed on cells of hematopoietic lineage including monocytes, lymphocytes, and granulocytes
- Function
- When complexed with TNFRI, recruits anti-apoptotic molecules c-IAP1 and c-IAP2 that possess ubiquitin ligase activity; cysteine rich extracellular region
- Interaction
- Interacts with TTRAP and TRAF2
- Ligand/Receptor
- TNF-α and TNF-β (LT-α)
- Cell Type
- Granulocytes, Lymphocytes, Monocytes
- Biology Area
- Cell Biology, Immunology, Innate Immunity, Neuroinflammation, Neuroscience, Transcription Factors
- Molecular Family
- CD Molecules
- Antigen References
-
1. Andrews JS, et al. 1990. J. Immunol. 144:2582.
2. Nophar Y, et al. 1990. EMBO J. 9:3269.
3. Kohno T, et al. 1990. Proc. Natl. Acad. Sci. USA 87:8331.
4. Tartaglia LA, et al. 1991. Proc. Natl. Acad. Sci. USA 88:9292.
5. Hijdra D, et al. 2012. J. Inflamm. (Lond). 9:38.
6. Chen X, et al. 2013. J. Immunol. 190:1076. - Gene ID
- 7133 View all products for this Gene ID
- UniProt
- View information about CD120b on UniProt.org
Other Formats
View All CD120b Reagents Request Custom ConjugationDescription | Clone | Applications |
---|---|---|
Purified anti-human CD120b | 3G7A02 | FC |
PE anti-human CD120b | 3G7A02 | FC |
APC anti-human CD120b | 3G7A02 | FC |
Ultra-LEAF™ Purified anti-human CD120b | 3G7A02 | Neut,FC |
Biotin anti-human CD120b | 3G7A02 | FC |
PE/Cyanine7 anti-human CD120b | 3G7A02 | FC |
PE/Dazzle™ 594 anti-human CD120b | 3G7A02 | FC |
TotalSeq™-A1024 anti-human CD120b | 3G7A02 | PG |
TotalSeq™-C1024 anti-human CD120b | 3G7A02 | PG |
TotalSeq™-D1024 anti-human CD120b Antibody | 3G7A02 | PG |
TotalSeq™-B1024 anti-human CD120b | 3G7A02 | PG |
Compare Data Across All Formats
This data display is provided for general comparisons between formats.
Your actual data may vary due to variations in samples, target cells, instruments and their settings, staining conditions, and other factors.
If you need assistance with selecting the best format contact our expert technical support team.
-
Purified anti-human CD120b
-
PE anti-human CD120b
-
APC anti-human CD120b
-
Ultra-LEAF™ Purified anti-human CD120b
-
Biotin anti-human CD120b
-
PE/Cyanine7 anti-human CD120b
-
PE/Dazzle™ 594 anti-human CD120b
-
TotalSeq™-A1024 anti-human CD120b
-
TotalSeq™-C1024 anti-human CD120b
-
TotalSeq™-D1024 anti-human CD120b Antibody
-
TotalSeq™-B1024 anti-human CD120b
Follow Us