- Clone
- 3D11/HLA-F (See other available formats)
- Regulatory Status
- RUO
- Other Names
- HLAF, CDA12, HLA-5.4, HLA-CDA12
- Isotype
- Mouse IgG1, κ
- Barcode Sequence
- GCAACTCTCCTACCT
- Ave. Rating
- Submit a Review
- Product Citations
- publications
Cat # | Size | Price | Quantity Check Availability | Save | ||
---|---|---|---|---|---|---|
373213 | 10 µg | $369 |
A 42kD member of non-classical or class Ib human MHC family. It exhibits low allelic polymorphism and shorter cytoplasmic tail due to absence of exon seven. It is expressed irrespective of bound peptide. It is primarily found intracellularly on Endoplasmic Reticulum and Golgi membrane and its surface expression increases in correlation with classical MHC-I up regulation in activated monocytes, B, T, and NK cells. It is involved in inflammatory responses. It stabilizes the unstable MHC-I Open Conformers (OC) and facilitates uptake of extracellular antigen for cross presentation.
Product DetailsProduct Details
- Verified Reactivity
- Human
- Antibody Type
- Monoclonal
- Host Species
- Mouse
- Immunogen
- Complex mixed with IFA, complex without adjuvant.
- Formulation
- Phosphate-buffered solution, pH 7.2, containing 0.09% sodium azide and EDTA
- Preparation
- The antibody was purified by chromatography and conjugated with TotalSeq™-D oligomer under optimal conditions.
- Concentration
- 0.5 mg/mL
- Storage & Handling
- The antibody solution should be stored undiluted between 2°C and 8°C. Do not freeze.
- Application
-
PG - Quality tested
- Recommended Usage
-
Each lot of this antibody is quality control tested by immunofluorescent staining with flow cytometric analysis and the oligomer sequence is confirmed by sequencing. TotalSeq™-D antibodies are compatible with Mission Bio’s Tapestri Single-Cell Sequencing Platform for simultaneous detection of DNA and Protein.
To maximize performance, it is strongly recommended that the reagent be titrated for each application, and that you centrifuge the antibody dilution before adding to the cells at 14,000xg at 2 - 8°C for 10 minutes. Carefully pipette out the liquid avoiding the bottom of the tube and add to the cell suspension. For Proteogenomics analysis, the suggested starting amount of this reagent for titration is ≤ 1.0 µg per million cells in 100 µL volume. Refer to the corresponding TotalSeq™ protocol for specific staining instructions.
Buyer is solely responsible for determining whether Buyer has all intellectual property rights that are necessary for Buyer's intended uses of the BioLegend TotalSeq™ products. For example, for any technology platform Buyer uses with TotalSeq™, it is Buyer's sole responsibility to determine whether it has all necessary third party intellectual property rights to use that platform and TotalSeq™ with that platform. - Additional Product Notes
-
TotalSeq™-D reagents are designed to profile protein expression at single cell level. The Mission Bio Tapestri platform and sequencer (e.g. Illumina analyzers) are required. Please contact technical support for more information, or visit biolegend.com/totalseq/single-cell-dna
The barcode flanking sequences are CGAGATGACTACGCTACTCATGG (PCR handle), and GAGCCGATCTAGTATCTCAGT*C*G (capture sequence). * indicates a phosphorothioated bond, to prevent nuclease degradation.
View more applications data for this product in our Application Technical Notes. -
Application References
(PubMed link indicates BioLegend citation) -
- Ishitani A, et al. 2003. J. Immunol. 171:1376.
- RRID
-
AB_3068302 (BioLegend Cat. No. 373213)
Antigen Details
- Structure
- 42 kD Single pass type I membrane protein, heterodimer of an alpha and a Beta chain.
- Distribution
-
B, NK, monocyte and T cells.
- Function
- MHC-I OC stabilization, antigen cross presentation.
- Ligand/Receptor
- KIR3DS1, KIR3DS4, KIR3DL2, ILT2, ILT4, TAP.
- Cell Type
- B cells, Monocytes, NK cells, T cells
- Biology Area
- Immunology
- Molecular Family
- MHC Antigens
- Antigen References
-
- Goodridge JP, et al. 2013. J. Immunol. 191:1567.
- Lepin EJ, et al. 2000. Eur. J. Immunol. 30:3552.
- Burian A,et al. 2016. PLoS One 11:e0163297.
- Lee N, et al. 2010. Eur. J. Immunol. 40:2308.
- Gene ID
- 3134 View all products for this Gene ID
- UniProt
- View information about HLA-F on UniProt.org
Related Pages & Pathways
Pages
Other Formats
View All HLA-F Reagents Request Custom ConjugationDescription | Clone | Applications |
---|---|---|
Purified anti-human HLA-F | 3D11/HLA-F | FC,Direct ELISA,IHC-F,IP |
PE anti-human HLA-F | 3D11/HLA-F | FC |
PE/Dazzle™ 594 anti-human HLA-F | 3D11/HLA-F | FC |
APC anti-human HLA-F | 3D11/HLA-F | FC |
TotalSeq™-C1047 anti-human HLA-F | 3D11/HLA-F | PG |
TotalSeq™-B1047 anti-human HLA-F | 3D11/HLA-F | PG |
TotalSeq™-D1047 anti-human HLA-F | 3D11/HLA-F | PG |
Compare Data Across All Formats
This data display is provided for general comparisons between formats.
Your actual data may vary due to variations in samples, target cells, instruments and their settings, staining conditions, and other factors.
If you need assistance with selecting the best format contact our expert technical support team.
Follow Us