TotalSeq™-A0001 anti-mouse CD4 Antibody

Pricing & Availability
Clone
RM4-5 (See other available formats)
Regulatory Status
RUO
Other Names
L3T4, T4
Isotype
Rat IgG2a, κ
Barcode Sequence
AACAAGACCCTTGAG
Compare all formats
Cat # Size Price Quantity Check Availability
100569 10 µg $369.00
Check Availability


Need larger quantities of this item?
Request Bulk Quote
Description

CD4 is a 55 kD protein also known as L3T4 or T4. It is a member of the Ig superfamily, primarily expressed on most thymocytes and a subset of T cells, and weakly on macrophages and dendritic cells. It acts as a co-receptor with the TCR during T cell activation and thymic differentiation by binding MHC class II and associating with the protein tyrosine kinase lck.

Technical data sheet

Product Details

Verified Reactivity
Mouse
Antibody Type
Monoclonal
Host Species
Rat
Immunogen
BALB/c mouse thymocytes
Formulation
Phosphate-buffered solution, pH 7.2, containing 0.09% sodium azide and EDTA
Preparation
The antibody was purified by chromatography and conjugated with TotalSeq™-A oligomer under optimal conditions.
Concentration
0.5 mg/ml
Storage & Handling
The antibody solution should be stored undiluted between 2°C and 8°C. Do not freeze.
Application

PG - Quality tested
Recommended Usage

Each lot of this antibody is quality control tested by immunofluorescent staining with flow cytometric analysis and the oligomer sequence is confirmed by sequencing. TotalSeq™-A antibodies are compatible with 10x Genomics Single Cell Gene Expression Solutions.

To maximize performance, it is strongly recommended that the reagent be titrated for each application, and that you centrifuge the antibody dilution before adding to the cells at 14,000xg at 2 - 8°C for 10 minutes. Carefully pipette out the liquid avoiding the bottom of the tube and add to the cell suspension. For Proteogenomics analysis, the suggested starting amount of this reagent for titration is ≤ 1.0 µg per million cells in 100 µL volume. Refer to the corresponding TotalSeq™ protocol for specific staining instructions.


Buyer is solely responsible for determining whether Buyer has all intellectual property rights that are necessary for Buyer's intended uses of the BioLegend TotalSeq™ products. For example, for any technology platform Buyer uses with TotalSeq™, it is Buyer's sole responsibility to determine whether it has all necessary third party intellectual property rights to use that platform and TotalSeq™ with that platform.
Application Notes

The RM4-5 antibody blocks the binding of GK1.5 antibody and H129.19 antibody to CD4+ T cells, but not RM4-4 antibody. Additional reported applications (for the relevant formats) include: blocking of ligand binding, in vivo depletion of CD4+ cells1, and immunohistochemistry of acetone-fixed frozen tissue sections2,3,11 and paraffin-embedded sections11. Clone RM4-5 is not recommended for immunohistochemistry of formalin-fixed paraffin sections. Instead, acetone frozen or zinc-fixed paraffin sections are recommended. The Ultra-LEAF™ Purified antibody (Endotoxin < 0.01 EU/µg, Azide-Free, 0.2 µm filtered) is recommended for functional assays (Cat. No. 100575 and 100576).

Additional Product Notes

TotalSeq™ reagents are designed to profile protein levels at a single cell level following an optimized protocol similar to the CITE-seq workflow. A compatible single cell device (e.g. 10x Genomics Chromium System and Reagents) and sequencer (e.g. Illumina analyzers) are required. Please contact technical support for more information, or visit biolegend.com/totalseq.

The barcode flanking sequences are CCTTGGCACCCGAGAATTCCA (PCR handle), and BAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA*A*A (capture sequence). B represents either C, G, or T, and * indicates a phosphorothioated bond, to prevent nuclease degradation.

View more applications data for this product in our Scientific Poster Library.

Application References

(PubMed link indicates BioLegend citation)
  1. Kruisbeek AM. 1991. In Curr. Protocols Immunol. pp. 4.1.1-4.1.5. (Block, Deplete)
  2. Nitta H, et al. 1997. Cell Vision 4:73. (IHC)
  3. Fan WY, et al. 2001. Exp. Biol. Med. 226:1045.
  4. Muraille E, et al. 2003. Infect. Immun. 71:2704. (IHC)
  5. León-Ponte M, et al. 2007. Blood 109:3139. (FC)
  6. Bourdeau A, et al. 2007. Blood doi:10.1182/blood-2006-08-044370. (FC)
  7. Matsumoto M, et al. 2007.J. Immunol.178:2499. PubMed
  8. Shigeta A, et al. 2008. Blood 112:4915. PubMed
  9. Zaborsky N, et al. 2010. J. Immunol. 184:725. PubMed
  10. Rodrigues-Manzanet R, et al. 2010. P. Natl Acad Sci USA 107:8706. PubMed
  11. Whiteland JL, et al. 1995. J. Histochem. Cytochem. 43:313. (IHC)
Product Citations
  1. Rødahl I, et al. 2021. STAR Protoc. 2:100842. PubMed
  2. Al-Rifai R, et al. 2022. Nat Commun. 13:6592. PubMed
  3. Golomb SM, et al. 2020. Cell Rep. 33:108438. PubMed
  4. Guldner IH, et al. 2020. Cell. 183(5):1234-1248.e25. PubMed
  5. Guilliams M, et al. 2022. Cell. 185:379. PubMed
  6. Guldner IH, et al. 2021. STAR Protocols. 2(2):100537. PubMed
  7. Pisu D, et al. 2021. J Exp Med. 218:. PubMed
RRID
AB_2749956 (BioLegend Cat. No. 100569)

Antigen Details

Structure
Ig superfamily, 55 kD
Distribution

Majority of thymocytes, T cell subset

Function
TCR co-receptor, T cell activation
Ligand/Receptor
MHC class II molecule
Cell Type
Dendritic cells, T cells, Thymocytes, Tregs
Biology Area
Immunology
Molecular Family
CD Molecules
Antigen References

1. Barclay A, et al. 1997. The Leukocyte Antigen FactsBook Academic Press.
2. Bierer BE, et al. 1989. Annu. Rev. Immunol. 7:579.
3. Janeway CA. 1992. Annu. Rev. Immunol. 10:645.

Gene ID
12504 View all products for this Gene ID
UniProt
View information about CD4 on UniProt.org
Go To Top Version: 1    Revision Date: 07/13/2018

8999 BioLegend Way, San Diego, CA 92121 www.biolegend.com
Toll-Free Phone: 1-877-Bio-Legend (246-5343) Phone: (858) 768-5800 Fax: (877) 455-9587

This data display is provided for general comparisons between formats.
Your actual data may vary due to variations in samples, target cells, instruments and their settings, staining conditions, and other factors.
If you need assistance with selecting the best format contact our expert technical support team.

Login/Register
Forgot your password? Reset Password
Request an Account