TotalSeq™-A0012 anti-mouse CD117 (c-kit) Antibody

Pricing & Availability
Clone
2B8 (See other available formats)
Regulatory Status
RUO
Other Names
c-KIT, Stem Cell Factor Receptor (SCFR)
Isotype
Rat IgG2b, κ
Barcode Sequence
TGCATGTCATCGGTG
Cat # Size Price Quantity Check Availability
105843 10 µg $369.00
Check Availability


Need larger quantities of this item?
Request Bulk Quote
Description

CD117 is a 145 kD immunoglobulin superfamily member also known as c-Kit and stem cell factor receptor (SCFR). It is a transmembrane tyrosine-kinase receptor that binds the c-Kit ligand (also known as steel factor, stem cell factor, and mast cell growth factor). CD117 is expressed on hematopoietic stem cells (including multipotent hematopoietic stem cells, progenitors committed to myeloid and/or erythroid lineages, and T and B cell precursors), mast cells, and acute myeloid leukemia (AML) cells. CD117 interaction with its ligand is critical for the development of hematopoietic stem cells.

Technical data sheet

Product Details

Verified Reactivity
Mouse
Antibody Type
Monoclonal
Host Species
Rat
Immunogen
Mouse bone marrow mast cells
Formulation
Phosphate-buffered solution, pH 7.2, containing 0.09% sodium azide and EDTA
Preparation
The antibody was purified by chromatography and conjugated with TotalSeq™-A oligomer under optimal conditions.
Concentration
0.5 mg/ml
Storage & Handling
The antibody solution should be stored undiluted between 2°C and 8°C. Do not freeze.
Application

PG - Quality tested

Recommended Usage

Each lot of this antibody is quality control tested by immunofluorescent staining with flow cytometric analysis and the oligomer sequence is confirmed by sequencing. TotalSeq™-A antibodies are compatible with 10x Genomics Single Cell Gene Expression Solutions.

To maximize performance, it is strongly recommended that the reagent be titrated for each application, and that you centrifuge the antibody dilution before adding to the cells at 14,000xg at 2 - 8°C for 10 minutes. Carefully pipette out the liquid avoiding the bottom of the tube and add to the cell suspension. For Proteogenomics analysis, the suggested starting amount of this reagent for titration is ≤ 1.0 µg per million cells in 100 µL volume. Refer to the corresponding TotalSeq™ protocol for specific staining instructions.


Buyer is solely responsible for determining whether Buyer has all intellectual property rights that are necessary for Buyer's intended uses of the BioLegend TotalSeq™ products. For example, for any technology platform Buyer uses with TotalSeq™, it is Buyer's sole responsibility to determine whether it has all necessary third party intellectual property rights to use that platform and TotalSeq™ with that platform.
Application Notes

Additional reported applications (for the relevant formats) include: immunoprecipitation1, immunohistochemistry of acetone fixed frozen sections2, and spatial biology (IBEX)5,6. The 2B8 antibody does not block c-Kit activity.

Additional Product Notes

TotalSeq™ reagents are designed to profile protein levels at a single cell level following an optimized protocol similar to the CITE-seq workflow. A compatible single cell device (e.g. 10x Genomics Chromium System and Reagents) and sequencer (e.g. Illumina analyzers) are required. Please contact technical support for more information, or visit biolegend.com/totalseq.

The barcode flanking sequences are CCTTGGCACCCGAGAATTCCA (PCR handle), and BAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA*A*A (capture sequence). B represents either C, G, or T, and * indicates a phosphorothioated bond, to prevent nuclease degradation.

View more applications data for this product in our Scientific Poster Library.

Application References

(PubMed link indicates BioLegend citation)
  1. Ikuta K, et al. 1992. P. Natl. Acad. Sci. USA 89:1502. (FC)
  2. Podd BS, et al. 2006. J. Immunol. 176:6532. PubMed (IHC)
  3. Bachelet I, et al. 2008. J. Immunol. 180:6064. PubMed (FC)
  4. Charles N, et al. 2010. Nat. Med. 16:701. PubMed (FC)
  5. Radtke AJ, et al. 2020. Proc Natl Acad Sci U S A. 117:33455-65. (SB) PubMed
  6. Radtke AJ, et al. 2022. Nat Protoc. 17:378-401. (SB) PubMed
Product Citations
  1. Rødahl I, et al. 2021. STAR Protoc. 2:100842. PubMed
  2. Al-Rifai R, et al. 2022. Nat Commun. 13:6592. PubMed
  3. Golomb SM, et al. 2020. Cell Rep. 33:108438. PubMed
  4. Guldner IH, et al. 2020. Cell. 183(5):1234-1248.e25. PubMed
  5. Guilliams M, et al. 2022. Cell. 185:379. PubMed
  6. Guldner IH, et al. 2021. STAR Protocols. 2(2):100537. PubMed
RRID
AB_2749960 (BioLegend Cat. No. 105843)

Antigen Details

Structure
Ig superfamily, 145 kD
Distribution

Hematopoietic stem cells, AML, mast cells

Function
Growth factor receptor, tyrosine kinase
Ligand/Receptor
Stem Cell Factor (SCF)
Cell Type
Embryonic Stem Cells, Hematopoietic stem and progenitors, Leukemia, Mast cells, Mesenchymal Stem Cells
Biology Area
Immunology, Stem Cells
Molecular Family
CD Molecules
Antigen References

1. Barclay A, et al. 1997. The Leukocyte Antigen FactsBook Academic Press.
2. Galli SJ, et al. 1994. Adv. Immunol. 55:1.
3. Ikuta K, et al. 1992. Annu. Rev. Immunol. 10:759.
4. Besmer P, et al. 1986. Nature 320:415.
5. Witte ON. 1990. Cell 63:5.

Gene ID
16590 View all products for this Gene ID
UniProt
View information about CD117 on UniProt.org

Other Formats

View All CD117 Reagents Request Custom Conjugation
Description Clone Applications
APC anti-mouse CD117 (c-Kit) 2B8 FC
Biotin anti-mouse CD117 (c-Kit) 2B8 FC
FITC anti-mouse CD117 (c-Kit) 2B8 FC
PE anti-mouse CD117 (c-Kit) 2B8 FC
PE/Cyanine5 anti-mouse CD117 (c-Kit) 2B8 FC
Purified anti-mouse CD117 (c-Kit) 2B8 FC,IHC-F
PE/Cyanine7 anti-mouse CD117 (c-Kit) 2B8 FC
Alexa Fluor® 488 anti-mouse CD117 (c-Kit) 2B8 FC,IHC-F
Alexa Fluor® 647 anti-mouse CD117 (c-Kit) 2B8 FC,IHC-F
Pacific Blue™ anti-mouse CD117 (c-Kit) 2B8 FC
PerCP/Cyanine5.5 anti-mouse CD117 (c-kit) 2B8 FC
PerCP anti-mouse CD117 (c-kit) 2B8 FC
APC/Cyanine7 anti-mouse CD117 (c-kit) 2B8 FC
Brilliant Violet 421™ anti-mouse CD117 (c-Kit) 2B8 FC,SB
Purified anti-mouse CD117 (c-Kit) (Maxpar® Ready) 2B8 FC,CyTOF®
PE/Dazzle™ 594 anti-mouse CD117 (c-Kit) 2B8 FC
Brilliant Violet 711™ anti-mouse CD117 (c-Kit) 2B8 FC
Alexa Fluor® 594 anti-mouse CD117 (c-Kit) 2B8 IHC-F,3D IHC
APC/Fire™ 750 anti-mouse CD117 (c-Kit) 2B8 FC
Brilliant Violet 510™ anti-mouse CD117 (c-Kit) 2B8 FC
Brilliant Violet 785™ anti-mouse CD117 (c-Kit) 2B8 FC
TotalSeq™-A0012 anti-mouse CD117 (c-kit) 2B8 PG
Brilliant Violet 605™ anti-mouse CD117 (c-Kit) 2B8 FC
Alexa Fluor® 700 anti-mouse CD117 (c-Kit) 2B8 FC
TotalSeq™-B0012 anti-mouse CD117 (c-Kit) 2B8 PG
TotalSeq™-C0012 anti-mouse CD117 (c-Kit) 2B8 PG
Spark NIR™ 685 anti-mouse CD117 (c-kit) 2B8 FC
Brilliant Violet 650™ anti-mouse CD117 (c-kit) 2B8 FC
Spark Red™ 718 anti-mouse CD117 (c-kit) (Flexi-Fluor™) 2B8 FC
Spark Blue™ 574 anti-mouse CD117 (c-kit) (Flexi-Fluor™) 2B8 FC
Spark Blue™ 550 anti-mouse CD117 (c-kit) (Flexi-Fluor™) 2B8 FC
Go To Top Version: 1    Revision Date: 07/18/2018

8999 BioLegend Way, San Diego, CA 92121 www.biolegend.com
Toll-Free Phone: 1-877-Bio-Legend (246-5343) Phone: (858) 768-5800 Fax: (877) 455-9587

This data display is provided for general comparisons between formats.
Your actual data may vary due to variations in samples, target cells, instruments and their settings, staining conditions, and other factors.
If you need assistance with selecting the best format contact our expert technical support team.

Login/Register
Forgot your password? Reset Password
Request an Account