- Clone
- 2B8 (See other available formats)
- Regulatory Status
- RUO
- Other Names
- c-KIT, Stem Cell Factor Receptor (SCFR)
- Isotype
- Rat IgG2b, κ
- Barcode Sequence
- TGCATGTCATCGGTG
Cat # | Size | Price | Quantity Check Availability | ||
---|---|---|---|---|---|
105843 | 10 µg | $369.00 |
CD117 is a 145 kD immunoglobulin superfamily member also known as c-Kit and stem cell factor receptor (SCFR). It is a transmembrane tyrosine-kinase receptor that binds the c-Kit ligand (also known as steel factor, stem cell factor, and mast cell growth factor). CD117 is expressed on hematopoietic stem cells (including multipotent hematopoietic stem cells, progenitors committed to myeloid and/or erythroid lineages, and T and B cell precursors), mast cells, and acute myeloid leukemia (AML) cells. CD117 interaction with its ligand is critical for the development of hematopoietic stem cells.
Product Details
- Verified Reactivity
- Mouse
- Antibody Type
- Monoclonal
- Host Species
- Rat
- Immunogen
- Mouse bone marrow mast cells
- Formulation
- Phosphate-buffered solution, pH 7.2, containing 0.09% sodium azide and EDTA
- Preparation
- The antibody was purified by chromatography and conjugated with TotalSeq™-A oligomer under optimal conditions.
- Concentration
- 0.5 mg/ml
- Storage & Handling
- The antibody solution should be stored undiluted between 2°C and 8°C. Do not freeze.
- Application
-
PG - Quality tested
- Recommended Usage
-
Each lot of this antibody is quality control tested by immunofluorescent staining with flow cytometric analysis and the oligomer sequence is confirmed by sequencing. TotalSeq™-A antibodies are compatible with 10x Genomics Single Cell Gene Expression Solutions.
To maximize performance, it is strongly recommended that the reagent be titrated for each application, and that you centrifuge the antibody dilution before adding to the cells at 14,000xg at 2 - 8°C for 10 minutes. Carefully pipette out the liquid avoiding the bottom of the tube and add to the cell suspension. For Proteogenomics analysis, the suggested starting amount of this reagent for titration is ≤ 1.0 µg per million cells in 100 µL volume. Refer to the corresponding TotalSeq™ protocol for specific staining instructions.
Buyer is solely responsible for determining whether Buyer has all intellectual property rights that are necessary for Buyer's intended uses of the BioLegend TotalSeq™ products. For example, for any technology platform Buyer uses with TotalSeq™, it is Buyer's sole responsibility to determine whether it has all necessary third party intellectual property rights to use that platform and TotalSeq™ with that platform. - Application Notes
-
Additional reported applications (for the relevant formats) include: immunoprecipitation1, immunohistochemistry of acetone fixed frozen sections2, and spatial biology (IBEX)5,6. The 2B8 antibody does not block c-Kit activity.
- Additional Product Notes
-
TotalSeq™ reagents are designed to profile protein levels at a single cell level following an optimized protocol similar to the CITE-seq workflow. A compatible single cell device (e.g. 10x Genomics Chromium System and Reagents) and sequencer (e.g. Illumina analyzers) are required. Please contact technical support for more information, or visit biolegend.com/totalseq.
The barcode flanking sequences are CCTTGGCACCCGAGAATTCCA (PCR handle), and BAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA*A*A (capture sequence). B represents either C, G, or T, and * indicates a phosphorothioated bond, to prevent nuclease degradation.
View more applications data for this product in our Scientific Poster Library. -
Application References
(PubMed link indicates BioLegend citation) -
- Ikuta K, et al. 1992. P. Natl. Acad. Sci. USA 89:1502. (FC)
- Podd BS, et al. 2006. J. Immunol. 176:6532. PubMed (IHC)
- Bachelet I, et al. 2008. J. Immunol. 180:6064. PubMed (FC)
- Charles N, et al. 2010. Nat. Med. 16:701. PubMed (FC)
- Radtke AJ, et al. 2020. Proc Natl Acad Sci U S A. 117:33455-65. (SB) PubMed
- Radtke AJ, et al. 2022. Nat Protoc. 17:378-401. (SB) PubMed
- Product Citations
-
- RRID
-
AB_2749960 (BioLegend Cat. No. 105843)
Antigen Details
- Structure
- Ig superfamily, 145 kD
- Distribution
-
Hematopoietic stem cells, AML, mast cells
- Function
- Growth factor receptor, tyrosine kinase
- Ligand/Receptor
- Stem Cell Factor (SCF)
- Cell Type
- Embryonic Stem Cells, Hematopoietic stem and progenitors, Leukemia, Mast cells, Mesenchymal Stem Cells
- Biology Area
- Immunology, Stem Cells
- Molecular Family
- CD Molecules
- Antigen References
-
1. Barclay A, et al. 1997. The Leukocyte Antigen FactsBook Academic Press.
2. Galli SJ, et al. 1994. Adv. Immunol. 55:1.
3. Ikuta K, et al. 1992. Annu. Rev. Immunol. 10:759.
4. Besmer P, et al. 1986. Nature 320:415.
5. Witte ON. 1990. Cell 63:5. - Gene ID
- 16590 View all products for this Gene ID
- UniProt
- View information about CD117 on UniProt.org
Other Formats
View All CD117 Reagents Request Custom ConjugationCompare Data Across All Formats
This data display is provided for general comparisons between formats.
Your actual data may vary due to variations in samples, target cells, instruments and their settings, staining conditions, and other factors.
If you need assistance with selecting the best format contact our expert technical support team.
-
APC anti-mouse CD117 (c-Kit)
-
Biotin anti-mouse CD117 (c-Kit)
-
FITC anti-mouse CD117 (c-Kit)
-
PE anti-mouse CD117 (c-Kit)
-
PE/Cyanine5 anti-mouse CD117 (c-Kit)
-
Purified anti-mouse CD117 (c-Kit)
-
PE/Cyanine7 anti-mouse CD117 (c-Kit)
-
Alexa Fluor® 488 anti-mouse CD117 (c-Kit)
-
Alexa Fluor® 647 anti-mouse CD117 (c-Kit)
-
Pacific Blue™ anti-mouse CD117 (c-Kit)
-
PerCP/Cyanine5.5 anti-mouse CD117 (c-kit)
-
PerCP anti-mouse CD117 (c-kit)
-
APC/Cyanine7 anti-mouse CD117 (c-kit)
-
Brilliant Violet 421™ anti-mouse CD117 (c-Kit)
-
Purified anti-mouse CD117 (c-Kit) (Maxpar® Ready)
-
PE/Dazzle™ 594 anti-mouse CD117 (c-Kit)
-
Brilliant Violet 711™ anti-mouse CD117 (c-Kit)
-
Alexa Fluor® 594 anti-mouse CD117 (c-Kit)
-
APC/Fire™ 750 anti-mouse CD117 (c-Kit)
-
Brilliant Violet 510™ anti-mouse CD117 (c-Kit)
-
Brilliant Violet 785™ anti-mouse CD117 (c-Kit)
-
TotalSeq™-A0012 anti-mouse CD117 (c-kit)
-
Brilliant Violet 605™ anti-mouse CD117 (c-Kit)
-
Alexa Fluor® 700 anti-mouse CD117 (c-Kit)
-
TotalSeq™-B0012 anti-mouse CD117 (c-Kit)
-
TotalSeq™-C0012 anti-mouse CD117 (c-Kit)
-
Spark NIR™ 685 anti-mouse CD117 (c-kit)
-
Brilliant Violet 650™ anti-mouse CD117 (c-kit)
-
Spark Red™ 718 anti-mouse CD117 (c-kit) (Flexi-Fluor™)
-
Spark Blue™ 574 anti-mouse CD117 (c-kit) (Flexi-Fluor™)
-
Spark Blue™ 550 anti-mouse CD117 (c-kit) (Flexi-Fluor™)