TotalSeq™-A0048 anti-human CD45 Antibody

Pricing & Availability
Clone
2D1 (See other available formats)
Regulatory Status
RUO
Other Names
Leukocyte Common Antigen (LCA), T200
Isotype
Mouse IgG1, κ
Barcode Sequence
TCCCTTGCGATTTAC
Cat # Size Price Quantity Check Availability
368543 10 µg $369.00
Check Availability


Need larger quantities of this item?
Request Bulk Quote
Description

CD45 is a 180 - 240 kD single chain type I membrane glycoprotein also known as leukocyte common antigen (LCA) and T200. It is a tyrosine phosphatase expressed on the plasma membrane of all hematopoietic cells, except erythrocytes or platelets. CD45 is a signaling molecule that regulates a variety of cellular processes including cell growth, differentiation, cell cycle, and oncogenic transformation. CD45 plays a critical role in T and B cell antigen receptor-mediated activation by dephosphorylating substrates including p56Lck, p59Fyn, and other Src family kinases. CD45 non-covalently associates with lymphocyte phosphatase-associated phosphoprotein (LPAP) on T and B lymphocytes. CD45 has been reported to bind galectin-1 and to be associated with several other cell surface antigens including CD1, CD2, CD3, and CD4.

Technical data sheet

Product Details

Verified Reactivity
Human
Antibody Type
Monoclonal
Host Species
Mouse
Immunogen
Human PBMC
Formulation
Phosphate-buffered solution, pH 7.2, containing 0.09% sodium azide and EDTA
Preparation
The antibody was purified by chromatography and conjugated with TotalSeq™-A oligomer under optimal conditions.
Concentration
0.5 mg/ml
Storage & Handling
The antibody solution should be stored undiluted between 2°C and 8°C. Do not freeze.
Application

PG - Quality tested

Recommended Usage

Each lot of this antibody is quality control tested by immunofluorescent staining with flow cytometric analysis and the oligomer sequence is confirmed by sequencing. TotalSeq™-A antibodies are compatible with 10x Genomics Single Cell Gene Expression Solutions.

To maximize performance, it is strongly recommended that the reagent be titrated for each application, and that you centrifuge the antibody dilution before adding to the cells at 14,000xg at 2 - 8°C for 10 minutes. Carefully pipette out the liquid avoiding the bottom of the tube and add to the cell suspension. For Proteogenomics analysis, the suggested starting amount of this reagent for titration is ≤ 1.0 µg per million cells in 100 µL volume. Refer to the corresponding TotalSeq™ protocol for specific staining instructions.


Buyer is solely responsible for determining whether Buyer has all intellectual property rights that are necessary for Buyer's intended uses of the BioLegend TotalSeq™ products. For example, for any technology platform Buyer uses with TotalSeq™, it is Buyer's sole responsibility to determine whether it has all necessary third party intellectual property rights to use that platform and TotalSeq™ with that platform.
Application Notes

It was found that the HI30 clone and the 2D1 clone can cross block each other's binding.

Additional Product Notes

TotalSeq™ reagents are designed to profile protein levels at a single cell level following an optimized protocol similar to the CITE-seq workflow. A compatible single cell device (e.g. 10x Genomics Chromium System and Reagents) and sequencer (e.g. Illumina analyzers) are required. Please contact technical support for more information, or visit biolegend.com/totalseq.

The barcode flanking sequences are CCTTGGCACCCGAGAATTCCA (PCR handle), and BAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA*A*A (capture sequence). B represents either C, G, or T, and * indicates a phosphorothioated bond, to prevent nuclease degradation.

View more applications data for this product in our Scientific Poster Library.

Application References

(PubMed link indicates BioLegend citation)
  1. Bradstock KF, et al. 1980. J. Natl. Cancer Inst. 65:33.
  2. Csiba A, et al. 1984. Br. J. Cancer 50:699.
  3. Tchilian EZ, et al. 2001. J. Immunol. 166:1308.
  4. Lee MS, et al. 2004. Int. Immunol. 16:1109.
Product Citations
  1. Witkowski MT, et al. 2020. Cancer Cell. 37:867. PubMed
  2. Hao Y, et al. 2021. Cell. 184:3573. PubMed
RRID
AB_2734418 (BioLegend Cat. No. 368543)

Antigen Details

Structure
Type I transmembrane protein, 180 - 240 kD (multiple isoforms)
Distribution

Hematopoietic cells, except circulating erythrocytes or platelets.

Function
Tyrosine phosphatases, signaling, co-stimulation (co-inhibition), TCR and BCR mediated activation.
Ligand/Receptor
Galectin-1, CD2, CD3, and CD4.
Cell Type
B cells, Dendritic cells, Neutrophils
Biology Area
Cell Biology, Immunology, Inhibitory Molecules, Neuroscience, Neuroscience Cell Markers
Molecular Family
CD Molecules, Protein Kinases/Phosphatase, TCRs
Antigen References

1. Thomas M. 1989. Annu. Rev. Immunol. 7:339.
2. Trowbridge I, et al. 1994. Annu. Rev. Immunol. 12:85.

Gene ID
5788 View all products for this Gene ID
UniProt
View information about CD45 on UniProt.org
Go To Top Version: 1    Revision Date: 05/29/2018

8999 BioLegend Way, San Diego, CA 92121 www.biolegend.com
Toll-Free Phone: 1-877-Bio-Legend (246-5343) Phone: (858) 768-5800 Fax: (877) 455-9587

This data display is provided for general comparisons between formats.
Your actual data may vary due to variations in samples, target cells, instruments and their settings, staining conditions, and other factors.
If you need assistance with selecting the best format contact our expert technical support team.

Login/Register
Forgot your password? Reset Password
Request an Account