TotalSeq™-A0054 anti-human CD34 Antibody

Pricing & Availability
Clone
581 (See other available formats)
Regulatory Status
RUO
Workshop
V MA27
Other Names
Gp105-120, My10
Isotype
Mouse IgG1, κ
Barcode Sequence
GCAGAAATCTCCCTT
Compare all formats
Cat # Size Price Quantity Check Availability
343537 10 µg $369.00
Check Availability


Need larger quantities of this item?
Request Bulk Quote
Description

CD34, also known as gp105-120, is a type I monomeric sialomucin-like glycophosphoprotein with an approximate molecular weight of 105-120 kD. Selectively expressed on the majority of hematopoietic stem/progenitor cells, bone marrow stromal cells, capillary endothelial cells, embryonic fibroblasts, and some nervous tissue, CD34 is a commonly used marker to identify human hematopoietic stem/progenitor cells. According to the differential sensitivity to enzymatic cleavage, four groups of epitopes of CD34 have been described. CD34 mediates cell adhesion and lymphocytes homing through binding to L-selectin and E-selectin ligands.

Technical data sheet

Product Details

Verified Reactivity
Human
Reported Reactivity
Cynomolgus
Antibody Type
Monoclonal
Host Species
Mouse
Formulation
Phosphate-buffered solution, pH 7.2, containing 0.09% sodium azide and EDTA
Preparation
The antibody was purified by chromatography and conjugated with TotalSeq™-A oligomer under optimal conditions.
Concentration
0.5 mg/ml
Storage & Handling
The antibody solution should be stored undiluted between 2°C and 8°C. Do not freeze.
Application

PG - Quality tested
Recommended Usage

Each lot of this antibody is quality control tested by immunofluorescent staining with flow cytometric analysis and the oligomer sequence is confirmed by sequencing. TotalSeq™-A antibodies are compatible with 10x Genomics Single Cell Gene Expression Solutions.

To maximize performance, it is strongly recommended that the reagent be titrated for each application, and that you centrifuge the antibody dilution before adding to the cells at 14,000xg at 2 - 8°C for 10 minutes. Carefully pipette out the liquid avoiding the bottom of the tube and add to the cell suspension. For Proteogenomics analysis, the suggested starting amount of this reagent for titration is ≤ 1.0 µg per million cells in 100 µL volume. Refer to the corresponding TotalSeq™ protocol for specific staining instructions.


Buyer is solely responsible for determining whether Buyer has all intellectual property rights that are necessary for Buyer's intended uses of the BioLegend TotalSeq™ products. For example, for any technology platform Buyer uses with TotalSeq™, it is Buyer's sole responsibility to determine whether it has all necessary third party intellectual property rights to use that platform and TotalSeq™ with that platform.
Application Notes

The 581 antibody recognizes the class III group epitope which is resistant to sialidase/glycolyprotease and chymopapain treatment. Additional reported applications (for the relevant formats) include: immunohistochemical staining of paraffin-embedded tissue sections5 and immunofluorescence6.

Additional Product Notes

TotalSeq™ reagents are designed to profile protein levels at a single cell level following an optimized protocol similar to the CITE-seq workflow. A compatible single cell device (e.g. 10x Genomics Chromium System and Reagents) and sequencer (e.g. Illumina analyzers) are required. Please contact technical support for more information, or visit biolegend.com/totalseq.

The barcode flanking sequences are CCTTGGCACCCGAGAATTCCA (PCR handle), and BAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA*A*A (capture sequence). B represents either C, G, or T, and * indicates a phosphorothioated bond, to prevent nuclease degradation.

View more applications data for this product in our Scientific Poster Library.

Application References

(PubMed link indicates BioLegend citation)
  1. Schlossman SF, et al. 1995. Leukocyte Typing V:White Cell Differentiation Antigen. New York:Oxford University Press.
  2. Felschow DM, et al. 2001. Blood 97:3768.
  3. Rudin CE, et al. 1997. Br. J. Haematol. 97:488.
  4. Yoshino N, et al. 2000. Exp. Anim. (Tokyo) 49:97. (FC)
  5. Skowasch D, et al. 2003. Cardiovasc Res. 60:684. (IHC)
  6. Umland O, et al. 2003. J. Histochem. Cytochem. 51:977. (IF)
Product Citations
  1. Carratt SA, et al. 2022. Blood. 140:644. PubMed
  2. Bachireddy P, et al. 2021. Cell Rep. 37:109992. PubMed
  3. Stuart T, et al. 2019. Cell. 177:1888. PubMed
  4. Witkowski MT, et al. 2020. Cancer Cell. 37:867. PubMed
  5. Guilliams M, et al. 2022. Cell. 185:379. PubMed
  6. Gomez-Collignon A, et al. 2022. Eur Cell Mater. 43:1. PubMed
  7. Lavaert M, et al. 2020. Immunity. 52(6):1088-1104. PubMed
  8. Hao Y, et al. 2021. Cell. 184:3573. PubMed
RRID
AB_2749972 (BioLegend Cat. No. 343537)

Antigen Details

Structure
105-120 kD single chain mucin-like glycoprotein
Distribution

Hematopoietic stem/progenitor cells, bone marrow stromal cells, endothelial cells, embryonic fibroblasts

Function
Cell adhesion
Ligand/Receptor
L-selectin, E-selectin
Cell Type
Endothelial cells, Fibroblasts, Hematopoietic stem and progenitors
Biology Area
Cell Biology, Immunology, Neuroinflammation, Neuroscience, Stem Cells
Molecular Family
CD Molecules
Antigen References

1. Krause DS, et al. 1996. Blood 87:1.
2. Puri KD, et al. 1995. J. Cell Biol. 131:261.
3. Zola H, et al. 2007. Leukocyte and Stromal Cell Molecules:The CD Markers. John Wiley & Sons Inc, Hoboken New Jersey.

Gene ID
947 View all products for this Gene ID
UniProt
View information about CD34 on UniProt.org
Go To Top Version: 1    Revision Date: 07/12/2018

8999 BioLegend Way, San Diego, CA 92121 www.biolegend.com
Toll-Free Phone: 1-877-Bio-Legend (246-5343) Phone: (858) 768-5800 Fax: (877) 455-9587

This data display is provided for general comparisons between formats.
Your actual data may vary due to variations in samples, target cells, instruments and their settings, staining conditions, and other factors.
If you need assistance with selecting the best format contact our expert technical support team.

Login/Register
Forgot your password? Reset Password
Request an Account