TotalSeq™-A0057 anti-human β2-microglobulin Antibody

Pricing & Availability
Clone
2M2 (See other available formats)
Regulatory Status
RUO
Other Names
β2M, β2-M, beta2-microglobulin b2-M, b2M
Isotype
Mouse IgG1, κ
Barcode Sequence
CAGCCCGATTAAGGT
Compare all formats
Cat # Size Price Quantity Check Availability
316321 10 µg $369.00
Check Availability


Need larger quantities of this item?
Request Bulk Quote
Description

β2-microglobulin (β2M) is a 12 kD nonpolymorphic Ig like protein. It is a non-membrane-anchored glycoprotein and is noncovalently associated with 39-44 kD polymorphic heavy chains of MHC class I molecules to form HLA class I antigen complex. In association with HLA class I, β2M is expressed on all leukocytes, platelets, endothelial cells, and epithelial cells. β2M plays an essential role both in governing MHC class I molecules stability and in promoting antigen binding and presenting the antigen to CD3/TCR complex of CD8+ T cells.

Technical data sheet

Product Details

Verified Reactivity
Human
Reported Reactivity
African Green, Baboon, Cynomolgus, Rhesus, Pig
Antibody Type
Monoclonal
Host Species
Mouse
Immunogen
Purified human β2-microglobulin
Formulation
Phosphate-buffered solution, pH 7.2, containing 0.09% sodium azide and EDTA
Preparation
The antibody was purified by chromatography and conjugated with TotalSeq™-A oligomer under optimal conditions.
Concentration
0.5 mg/ml
Storage & Handling
The antibody solution should be stored undiluted between 2°C and 8°C. Do not freeze.
Application

PG - Quality tested
Recommended Usage

Each lot of this antibody is quality control tested by immunofluorescent staining with flow cytometric analysis and the oligomer sequence is confirmed by sequencing. TotalSeq™-A antibodies are compatible with 10x Genomics Single Cell Gene Expression Solutions.

To maximize performance, it is strongly recommended that the reagent be titrated for each application, and that you centrifuge the antibody dilution before adding to the cells at 14,000xg at 2 - 8°C for 10 minutes. Carefully pipette out the liquid avoiding the bottom of the tube and add to the cell suspension. For Proteogenomics analysis, the suggested starting amount of this reagent for titration is ≤ 1.0 µg per million cells in 100 µL volume. Refer to the corresponding TotalSeq™ protocol for specific staining instructions.


Buyer is solely responsible for determining whether Buyer has all intellectual property rights that are necessary for Buyer's intended uses of the BioLegend TotalSeq™ products. For example, for any technology platform Buyer uses with TotalSeq™, it is Buyer's sole responsibility to determine whether it has all necessary third party intellectual property rights to use that platform and TotalSeq™ with that platform.
Application Notes

Additional reported applications (for the relevant formats) include: Western blotting, and ELISA.

Additional Product Notes

TotalSeq™ reagents are designed to profile protein levels at a single cell level following an optimized protocol similar to the CITE-seq workflow. A compatible single cell device (e.g. 10x Genomics Chromium System and Reagents) and sequencer (e.g. Illumina analyzers) are required. Please contact technical support for more information, or visit biolegend.com/totalseq.

The barcode flanking sequences are CCTTGGCACCCGAGAATTCCA (PCR handle), and BAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA*A*A (capture sequence). B represents either C, G, or T, and * indicates a phosphorothioated bond, to prevent nuclease degradation.

View more applications data for this product in our Scientific Poster Library.

Application References

(PubMed link indicates BioLegend citation)
  1. Meissner TB, et al. 2010. Proc Natl Acad Sci USA. PubMed
  2. Rizvi SM, et al. 2011. J. Immunol. 186:2309. PubMed
  3. Meissner TB, et al. 2012. J Immunol. 188:4951. PubMed.
Product Citations
  1. Guilliams M, et al. 2022. Cell. 185:379. PubMed
RRID
AB_2749975 (BioLegend Cat. No. 316321)

Antigen Details

Structure
Nonpolymorphic Ig like structure, noncovalently associated with heavy chain of MHC class I molecules, 12 kD
Distribution

Leukocytes, platelets, endothelial cells, epithelial cells

Function
Govern MHC class I molecule stability, promote MHC class I molecules binding and presenting peptide antigens to CD8+ T cells
Ligand/Receptor
CD3/TCR complex, CD8
Cell Type
Endothelial cells, Epithelial cells, Leukocytes, Platelets
Biology Area
Immunology
Molecular Family
MHC Antigens
Antigen References

1. Engelhard VH. 1994. Curr. Opin. Immunol. 6:13.
2. Williams DB, et al. 1989. J. Immunol. 142:2796.
3. Danliczyk UG and TL. Delovitch. 1994. J. Immunol. 153:3533.
4. Williams A, et al. 2002. Tissue Antigens 59:3.

Gene ID
567 View all products for this Gene ID
UniProt
View information about beta2-microglobulin on UniProt.org
Go To Top Version: 1    Revision Date: 07/13/2018

8999 BioLegend Way, San Diego, CA 92121 www.biolegend.com
Toll-Free Phone: 1-877-Bio-Legend (246-5343) Phone: (858) 768-5800 Fax: (877) 455-9587

This data display is provided for general comparisons between formats.
Your actual data may vary due to variations in samples, target cells, instruments and their settings, staining conditions, and other factors.
If you need assistance with selecting the best format contact our expert technical support team.

Login/Register
Forgot your password? Reset Password
Request an Account