- Clone
- PC61 (See other available formats)
- Regulatory Status
- RUO
- Other Names
- IL-2Rα, Ly-43, p55, Tac
- Isotype
- Rat IgG1, λ
- Barcode Sequence
- ACCATGAGACACAGT
Cat # | Size | Price | Quantity Check Availability | ||
---|---|---|---|---|---|
102055 | 10 µg | $369.00 |
CD25 is a 55 kD glycoprotein also known as the low affinity IL-2Rα, Ly-43, p55, or Tac. It is expressed on activated T and B cells, thymocyte subsets, pre-B cells, and T regulatory cells. In association with CD122 (IL-2Rβ) and CD132 (common γ chain), CD25 forms the high affinity signaling IL-2 receptor.
Product Details
- Verified Reactivity
- Mouse
- Antibody Type
- Monoclonal
- Host Species
- Rat
- Immunogen
- IL-2-dependent cytolytic mouse T-cell clone B6.1
- Formulation
- Phosphate-buffered solution, pH 7.2, containing 0.09% sodium azide and EDTA
- Preparation
- The antibody was purified by chromatography and conjugated with TotalSeq™-A oligomer under optimal conditions.
- Concentration
- 0.5 mg/ml
- Storage & Handling
- The antibody solution should be stored undiluted between 2°C and 8°C. Do not freeze.
- Application
-
PG - Quality tested
- Recommended Usage
-
Each lot of this antibody is quality control tested by immunofluorescent staining with flow cytometric analysis and the oligomer sequence is confirmed by sequencing. TotalSeq™-A antibodies are compatible with 10x Genomics Single Cell Gene Expression Solutions.
To maximize performance, it is strongly recommended that the reagent be titrated for each application, and that you centrifuge the antibody dilution before adding to the cells at 14,000xg at 2 - 8°C for 10 minutes. Carefully pipette out the liquid avoiding the bottom of the tube and add to the cell suspension. For Proteogenomics analysis, the suggested starting amount of this reagent for titration is ≤ 1.0 µg per million cells in 100 µL volume. Refer to the corresponding TotalSeq™ protocol for specific staining instructions.
Buyer is solely responsible for determining whether Buyer has all intellectual property rights that are necessary for Buyer's intended uses of the BioLegend TotalSeq™ products. For example, for any technology platform Buyer uses with TotalSeq™, it is Buyer's sole responsibility to determine whether it has all necessary third party intellectual property rights to use that platform and TotalSeq™ with that platform. - Application Notes
-
Additional reported applications (for the relevant formats) include: immunoprecipitation1,2, in vitro blocking of IL-2 binding to low- and high-affinity receptors1-4, growth inhibition of IL-2-dependent T-cell lines1-4, in vivo depletion of CD25+CD4+ Treg cells5-8,10, and immunohistochemical staining of acetone-fixed frozen sections2. PC61 antibody recognizes a different epitope than 3C7 antibody (Cat. No. 101902). For in vivo studies or highly sensitive assays, we recommend Ultra-LEAF™ purified antibody (Cat. No. 102040) with endotoxin < 0.01 EU/µg, Azide-Free, 0.2 µm filtered.
- Additional Product Notes
-
TotalSeq™ reagents are designed to profile protein levels at a single cell level following an optimized protocol similar to the CITE-seq workflow. A compatible single cell device (e.g. 10x Genomics Chromium System and Reagents) and sequencer (e.g. Illumina analyzers) are required. Please contact technical support for more information, or visit biolegend.com/totalseq.
The barcode flanking sequences are CCTTGGCACCCGAGAATTCCA (PCR handle), and BAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA*A*A (capture sequence). B represents either C, G, or T, and * indicates a phosphorothioated bond, to prevent nuclease degradation.
View more applications data for this product in our Scientific Poster Library. -
Application References
(PubMed link indicates BioLegend citation) -
- Lowenthal JW, et al. 1985. Nature 315:669. (IP, Block)
- Ceredig R, et al. 1985. Nature 314:98. (IP, IHC, Block)
- Lowenthal JW, et al. 1985. J. Immunol. 135:3988. (Block)
- Moreau JL, et al. 1987. Eur. J. Immunol. 17:929. (Block)
- Takahashi T, et al. 2000. J. Exp. Med. 192:303. (Deplete)
- Onizuka S, et al. 1999. Cancer Res. 59:3128. (Deplete)
- Lei TC, et al. 2005. Blood 105:4865. (Deplete)
- Pasare C, et al. 2004. Immunity 21:733. (Deplete)
- León-Ponte M, et al. 2007. Blood 109:3139.
- Cao OW, et al. 2007. Blood doi:10.1182/blood-2007-02-073304. (Deplete)
- Benson MJ, et al. 2007. J. Exp. Med. doi:10.1084/jem.20070719.
- Liu F, et al. 2011. Arch Toxicol. 85:1383. PubMed
- Anguela XM, et al. 2013. Diabetes. 62:551. PubMed
- Product Citations
-
- RRID
-
AB_2749982 (BioLegend Cat. No. 102055)
Antigen Details
- Structure
- Forms high affinity IL-2R with IL-2Rβ (CD122) and IL-2Rγ (CD132), 55 kD
- Distribution
-
Activated T cells and B cells, thymocyte subset, pre-B cells, T regulatory cells
- Function
- IL-2 receptor
- Ligand/Receptor
- IL-2
- Cell Type
- B cells, T cells, Thymocytes, Tregs
- Biology Area
- Immunology
- Molecular Family
- CD Molecules, Cytokine/Chemokine Receptors
- Antigen References
-
- Taniguchi T, et al. 1993. Cell 73:5-8.
- Waldmann TA. 1991. J Biol Chem. 266:2681-4.
- Read S, et al. 2000. J Exp Med. 192:295-302.
- Lowenthal JW, et al. 1985. J Immunol. 135:3988-94.
- Gene ID
- 16184 View all products for this Gene ID
- UniProt
- View information about CD25 on UniProt.org
Other Formats
View All CD25 Reagents Request Custom ConjugationCompare Data Across All Formats
This data display is provided for general comparisons between formats.
Your actual data may vary due to variations in samples, target cells, instruments and their settings, staining conditions, and other factors.
If you need assistance with selecting the best format contact our expert technical support team.
-
APC anti-mouse CD25
-
Biotin anti-mouse CD25
-
FITC anti-mouse CD25
-
PE anti-mouse CD25
-
PE/Cyanine5 anti-mouse CD25
-
Purified anti-mouse CD25
-
PE/Cyanine7 anti-mouse CD25
-
Alexa Fluor® 488 anti-mouse CD25
-
Alexa Fluor® 647 anti-mouse CD25
-
Pacific Blue™ anti-mouse CD25
-
Alexa Fluor® 700 anti-mouse CD25
-
APC/Cyanine7 anti-mouse CD25
-
PerCP/Cyanine5.5 anti-mouse CD25
-
PerCP anti-mouse CD25
-
Brilliant Violet 421™ anti-mouse CD25
-
Brilliant Violet 605™ anti-mouse CD25
-
Brilliant Violet 650™ anti-mouse CD25
-
Ultra-LEAF™ Purified anti-mouse CD25
-
Brilliant Violet 510™ anti-mouse CD25
-
PE/Dazzle™ 594 anti-mouse CD25
-
Brilliant Violet 711™ anti-mouse CD25
-
Brilliant Violet 785™ anti-mouse CD25
-
Alexa Fluor® 594 anti-mouse CD25
-
APC/Fire™ 750 anti-mouse CD25
-
TotalSeq™-A0097 anti-mouse CD25
-
KIRAVIA Blue 520™ anti-mouse CD25
-
TotalSeq™-B0097 anti-mouse CD25
-
TotalSeq™-C0097 anti-mouse CD25
-
Spark NIR™ 685 anti-mouse CD25 Antibody
-
PE/Fire™ 640 anti-mouse CD25
-
Spark YG™ 581 anti-mouse CD25
-
APC/Fire™ 810 anti-mouse CD25
-
Brilliant Violet 750™ anti-mouse CD25
-
PerCP/Fire™ 780 anti-mouse CD25
-
PE/Fire™ 700 anti-mouse CD25
-
Spark PLUS UV395™ anti-mouse CD25
-
Spark Blue™ 574 anti-mouse CD25 (Flexi-Fluor™)