TotalSeq™-A0097 anti-mouse CD25 Antibody

Pricing & Availability
Clone
PC61 (See other available formats)
Regulatory Status
RUO
Other Names
IL-2Rα, Ly-43, p55, Tac
Isotype
Rat IgG1, λ
Barcode Sequence
ACCATGAGACACAGT
Cat # Size Price Quantity Check Availability
102055 10 µg $369.00
Check Availability


Need larger quantities of this item?
Request Bulk Quote
Description

CD25 is a 55 kD glycoprotein also known as the low affinity IL-2Rα, Ly-43, p55, or Tac. It is expressed on activated T and B cells, thymocyte subsets, pre-B cells, and T regulatory cells. In association with CD122 (IL-2Rβ) and CD132 (common γ chain), CD25 forms the high affinity signaling IL-2 receptor.

Technical data sheet

Product Details

Verified Reactivity
Mouse
Antibody Type
Monoclonal
Host Species
Rat
Immunogen
IL-2-dependent cytolytic mouse T-cell clone B6.1
Formulation
Phosphate-buffered solution, pH 7.2, containing 0.09% sodium azide and EDTA
Preparation
The antibody was purified by chromatography and conjugated with TotalSeq™-A oligomer under optimal conditions.
Concentration
0.5 mg/ml
Storage & Handling
The antibody solution should be stored undiluted between 2°C and 8°C. Do not freeze.
Application

PG - Quality tested

Recommended Usage

Each lot of this antibody is quality control tested by immunofluorescent staining with flow cytometric analysis and the oligomer sequence is confirmed by sequencing. TotalSeq™-A antibodies are compatible with 10x Genomics Single Cell Gene Expression Solutions.

To maximize performance, it is strongly recommended that the reagent be titrated for each application, and that you centrifuge the antibody dilution before adding to the cells at 14,000xg at 2 - 8°C for 10 minutes. Carefully pipette out the liquid avoiding the bottom of the tube and add to the cell suspension. For Proteogenomics analysis, the suggested starting amount of this reagent for titration is ≤ 1.0 µg per million cells in 100 µL volume. Refer to the corresponding TotalSeq™ protocol for specific staining instructions.


Buyer is solely responsible for determining whether Buyer has all intellectual property rights that are necessary for Buyer's intended uses of the BioLegend TotalSeq™ products. For example, for any technology platform Buyer uses with TotalSeq™, it is Buyer's sole responsibility to determine whether it has all necessary third party intellectual property rights to use that platform and TotalSeq™ with that platform.
Application Notes

Additional reported applications (for the relevant formats) include: immunoprecipitation1,2, in vitro blocking of IL-2 binding to low- and high-affinity receptors1-4, growth inhibition of IL-2-dependent T-cell lines1-4, in vivo depletion of CD25+CD4+ Treg cells5-8,10, and immunohistochemical staining of acetone-fixed frozen sections2. PC61 antibody recognizes a different epitope than 3C7 antibody (Cat. No. 101902). For in vivo studies or highly sensitive assays, we recommend Ultra-LEAF™ purified antibody (Cat. No. 102040) with endotoxin < 0.01 EU/µg, Azide-Free, 0.2 µm filtered. 

Additional Product Notes

TotalSeq™ reagents are designed to profile protein levels at a single cell level following an optimized protocol similar to the CITE-seq workflow. A compatible single cell device (e.g. 10x Genomics Chromium System and Reagents) and sequencer (e.g. Illumina analyzers) are required. Please contact technical support for more information, or visit biolegend.com/totalseq.

The barcode flanking sequences are CCTTGGCACCCGAGAATTCCA (PCR handle), and BAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA*A*A (capture sequence). B represents either C, G, or T, and * indicates a phosphorothioated bond, to prevent nuclease degradation.

View more applications data for this product in our Scientific Poster Library.

Application References

(PubMed link indicates BioLegend citation)
  1. Lowenthal JW, et al. 1985. Nature 315:669. (IP, Block)
  2. Ceredig R, et al. 1985. Nature 314:98. (IP, IHC, Block)
  3. Lowenthal JW, et al. 1985. J. Immunol. 135:3988. (Block)
  4. Moreau JL, et al. 1987. Eur. J. Immunol. 17:929. (Block)
  5. Takahashi T, et al. 2000. J. Exp. Med. 192:303. (Deplete)
  6. Onizuka S, et al. 1999. Cancer Res. 59:3128. (Deplete)
  7. Lei TC, et al. 2005. Blood 105:4865. (Deplete)
  8. Pasare C, et al. 2004. Immunity 21:733. (Deplete)
  9. León-Ponte M, et al. 2007. Blood 109:3139.
  10. Cao OW, et al. 2007. Blood doi:10.1182/blood-2007-02-073304. (Deplete)
  11. Benson MJ, et al. 2007. J. Exp. Med. doi:10.1084/jem.20070719.
  12. Liu F, et al. 2011. Arch Toxicol. 85:1383. PubMed
  13. Anguela XM, et al. 2013. Diabetes. 62:551. PubMed
Product Citations
  1. Kedmi R, et al. 2022. Nature. 610:737. PubMed
  2. Lee RD, et al. 2021. Nat Commun. 12:6843. PubMed
  3. Golomb SM, et al. 2020. Cell Rep. 33:108438. PubMed
  4. Guldner IH, et al. 2020. Cell. 183(5):1234-1248.e25. PubMed
  5. Guldner IH, et al. 2021. STAR Protocols. 2(2):100537. PubMed
RRID
AB_2749982 (BioLegend Cat. No. 102055)

Antigen Details

Structure
Forms high affinity IL-2R with IL-2Rβ (CD122) and IL-2Rγ (CD132), 55 kD
Distribution

Activated T cells and B cells, thymocyte subset, pre-B cells, T regulatory cells

Function
IL-2 receptor
Ligand/Receptor
IL-2
Cell Type
B cells, T cells, Thymocytes, Tregs
Biology Area
Immunology
Molecular Family
CD Molecules, Cytokine/Chemokine Receptors
Antigen References
  1. Taniguchi T, et al. 1993. Cell 73:5-8.
  2. Waldmann TA. 1991. J Biol Chem. 266:2681-4.
  3. Read S, et al. 2000. J Exp Med. 192:295-302.
  4. Lowenthal JW, et al. 1985. J Immunol. 135:3988-94.
Gene ID
16184 View all products for this Gene ID
UniProt
View information about CD25 on UniProt.org

Other Formats

View All CD25 Reagents Request Custom Conjugation
Description Clone Applications
APC anti-mouse CD25 PC61 FC
Biotin anti-mouse CD25 PC61 FC
FITC anti-mouse CD25 PC61 FC
PE anti-mouse CD25 PC61 FC
PE/Cyanine5 anti-mouse CD25 PC61 FC
Purified anti-mouse CD25 PC61 FC,IHC-F,IP,Block,Depletion
PE/Cyanine7 anti-mouse CD25 PC61 FC
Alexa Fluor® 488 anti-mouse CD25 PC61 FC
Alexa Fluor® 647 anti-mouse CD25 PC61 FC
Pacific Blue™ anti-mouse CD25 PC61 FC
Alexa Fluor® 700 anti-mouse CD25 PC61 FC
APC/Cyanine7 anti-mouse CD25 PC61 FC
PerCP/Cyanine5.5 anti-mouse CD25 PC61 FC
PerCP anti-mouse CD25 PC61 FC
Brilliant Violet 421™ anti-mouse CD25 PC61 FC
Brilliant Violet 605™ anti-mouse CD25 PC61 FC
Brilliant Violet 650™ anti-mouse CD25 PC61 FC
Ultra-LEAF™ Purified anti-mouse CD25 PC61 FC,IHC-F,IP,Block,Depletion
Brilliant Violet 510™ anti-mouse CD25 PC61 FC
PE/Dazzle™ 594 anti-mouse CD25 PC61 FC
Brilliant Violet 711™ anti-mouse CD25 PC61 FC
Brilliant Violet 785™ anti-mouse CD25 PC61 FC
Alexa Fluor® 594 anti-mouse CD25 PC61 IHC-F
APC/Fire™ 750 anti-mouse CD25 PC61 FC
TotalSeq™-A0097 anti-mouse CD25 PC61 PG
KIRAVIA Blue 520™ anti-mouse CD25 PC61 FC
TotalSeq™-B0097 anti-mouse CD25 PC61 PG
TotalSeq™-C0097 anti-mouse CD25 PC61 PG
Spark NIR™ 685 anti-mouse CD25 Antibody PC61 FC
PE/Fire™ 640 anti-mouse CD25 PC61 FC
Spark YG™ 581 anti-mouse CD25 PC61 FC
APC/Fire™ 810 anti-mouse CD25 PC61 FC
Brilliant Violet 750™ anti-mouse CD25 PC61 FC
PerCP/Fire™ 780 anti-mouse CD25 PC61 FC
PE/Fire™ 700 anti-mouse CD25 PC61 FC
Spark PLUS UV395™ anti-mouse CD25 PC61 FC
Spark Blue™ 574 anti-mouse CD25 (Flexi-Fluor™) PC61 FC
Go To Top Version: 1    Revision Date: 07/19/2018

8999 BioLegend Way, San Diego, CA 92121 www.biolegend.com
Toll-Free Phone: 1-877-Bio-Legend (246-5343) Phone: (858) 768-5800 Fax: (877) 455-9587

This data display is provided for general comparisons between formats.
Your actual data may vary due to variations in samples, target cells, instruments and their settings, staining conditions, and other factors.
If you need assistance with selecting the best format contact our expert technical support team.

Login/Register
Forgot your password? Reset Password
Request an Account