TotalSeq™-A0112 anti-mouse CD62L Antibody

Pricing & Availability
Clone
MEL-14 (See other available formats)
Regulatory Status
RUO
Other Names
L-selectin, LECAM-1, Ly-22, LAM-1, MEL-14
Isotype
Rat IgG2a, κ
Barcode Sequence
TGGGCCTAAGTCATC
Compare all formats
Cat # Size Price Quantity Check Availability
104451 10 µg $369.00
Check Availability


Need larger quantities of this item?
Request Bulk Quote
Description

CD62L is a 74-95 kD glycoprotein also known as L-selectin, LECAM-1, Ly-22, LAM-1, and MEL-14. It is a member of the selectin family and is expressed on the majority of B and naïve T cells, a subset of memory T cells, monocytes, granulocytes, most thymocytes, and a subset of NK cells. CD62L is important in lymphocyte homing to high endothelial venules (HEV) in peripheral lymph nodes and leukocyte "rolling" on activated endothelium. CD62L also contributes to neutrophil emigration at inflammatory sites. CD62L is rapidly shed from lymphocytes and neutrophils upon cellular activation and the expression levels of CD62L (in conjunction with other markers) have been used to distinguish naïve, effector, and memory T cells. CD62L has been reported to interact with CD34, GlyCAM-1, and MAdCAM-1.

Technical data sheet

Product Details

Verified Reactivity
Mouse
Antibody Type
Monoclonal
Host Species
Rat
Immunogen
C3H/eb mouse B lymphoma 38C-13
Formulation
Phosphate-buffered solution, pH 7.2, containing 0.09% sodium azide and EDTA
Preparation
The antibody was purified by chromatography and conjugated with TotalSeq™-A oligomer under optimal conditions.
Concentration
0.5 mg/ml
Storage & Handling
The antibody solution should be stored undiluted between 2°C and 8°C. Do not freeze.
Application

PG - Quality tested
Recommended Usage

Each lot of this antibody is quality control tested by immunofluorescent staining with flow cytometric analysis and the oligomer sequence is confirmed by sequencing. TotalSeq™-A antibodies are compatible with 10x Genomics Single Cell Gene Expression Solutions.

To maximize performance, it is strongly recommended that the reagent be titrated for each application, and that you centrifuge the antibody dilution before adding to the cells at 14,000xg at 2 - 8°C for 10 minutes. Carefully pipette out the liquid avoiding the bottom of the tube and add to the cell suspension. For Proteogenomics analysis, the suggested starting amount of this reagent for titration is ≤ 1.0 µg per million cells in 100 µL volume. Refer to the corresponding TotalSeq™ protocol for specific staining instructions.


Buyer is solely responsible for determining whether Buyer has all intellectual property rights that are necessary for Buyer's intended uses of the BioLegend TotalSeq™ products. For example, for any technology platform Buyer uses with TotalSeq™, it is Buyer's sole responsibility to determine whether it has all necessary third party intellectual property rights to use that platform and TotalSeq™ with that platform.
Application Notes

Additional reported applications (for the relevant formats) include: immunoprecipitation1-3, complement-dependent cytotoxicity4, in vivo and in vitro blocking of adhesion1-3,5, and immunohistochemical staining of acetone-fixed frozen sections and zinc-fixed paraffin-embedded sections6. The Ultra-LEAF™ purified antibody (Endotoxin < 0.01 EU/µg, Azide-Free, 0.2 µm filtered) is recommended for functional assays (Cat. Nos. 104457-104462).

Additional Product Notes

TotalSeq™ reagents are designed to profile protein levels at a single cell level following an optimized protocol similar to the CITE-seq workflow. A compatible single cell device (e.g. 10x Genomics Chromium System and Reagents) and sequencer (e.g. Illumina analyzers) are required. Please contact technical support for more information, or visit biolegend.com/totalseq.

The barcode flanking sequences are CCTTGGCACCCGAGAATTCCA (PCR handle), and BAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA*A*A (capture sequence). B represents either C, G, or T, and * indicates a phosphorothioated bond, to prevent nuclease degradation.

View more applications data for this product in our Scientific Poster Library.

Application References

(PubMed link indicates BioLegend citation)
  1. Gallatin WM, et al. 1983. Nature 304:30. (IP, Block)
  2. Siegelman MH, et al. 1990. Cell 61:611. (IP, Block)
  3. Lewinsohn DM, et al. 1987. J. Immunol. 138:4313. (IP, Block)
  4. Iwabuchi K, et al. 1991. Immunobiology 182:161. (CMCD)
  5. Pizcueta P, et al. 1994. Am. J. Pathol. 145:461.
  6. Reichert RA, et al. 1986. J. Immunol. 136:3535. (IHC, FC)
  7. Olver S, et al. 2006. Cancer Res. 66:571.
  8. Fukushima A, et al. 2006. Invest. Ophthalmol. Vis. Sci. 47:657. PubMed
  9. Benson MJ, et al. 2007. J. Exp. Med. doi:10.1084/jem.20070719. (FC) PubMed
  10. Chappaz S, et al. 2007. Blood doi:10.1182/blood-2007-02-074245. (FC) PubMed
  11. Lee JW, et al. 2006. Nature Immunol. 8:181.
  12. Shigeta A, et al. 2008. Blood 112:4915 (FC) PubMed
  13. de Vries VC, et al. 2009. Am. J. Transplant. 9:2270 PubMed
Product Citations
  1. Al-Rifai R, et al. 2022. Nat Commun. 13:6592. PubMed
  2. Sun Y, et al. 2020. J Immunol. 205:2649. PubMed
RRID
AB_2750364 (BioLegend Cat. No. 104451)

Antigen Details

Structure
Selectin, 95 kD (neutrophils) or 74 kD (lymphocytes)
Distribution

Subsets of B and T cells, monocytes, granulocytes, subset of NK cells

Function
Lymphocyte homing to HEV, rolling on activated endothelium
Ligand/Receptor
CD34, GlyCAM-1, MAdCAM-1
Cell Type
B cells, Granulocytes, Monocytes, Neutrophils, NK cells, T cells, Tregs
Biology Area
Cell Adhesion, Cell Biology, Costimulatory Molecules, Immunology, Innate Immunity
Molecular Family
Adhesion Molecules, CD Molecules
Antigen References

1. Barclay AN, et al. 1997. The Leukocyte Antigen FactsBook Academic Press.
2. Kishimoto TK, et al. 1990. P. Natl. Acad. Sci. USA 87:2244.
3. Tedder TF, et al. 1995. J. Exp. Med. 181:2259.

Gene ID
20343 View all products for this Gene ID
UniProt
View information about CD62L on UniProt.org
Go To Top Version: 1    Revision Date: 08/30/2018

8999 BioLegend Way, San Diego, CA 92121 www.biolegend.com
Toll-Free Phone: 1-877-Bio-Legend (246-5343) Phone: (858) 768-5800 Fax: (877) 455-9587

This data display is provided for general comparisons between formats.
Your actual data may vary due to variations in samples, target cells, instruments and their settings, staining conditions, and other factors.
If you need assistance with selecting the best format contact our expert technical support team.

Login/Register
Forgot your password? Reset Password
Request an Account