TotalSeq™-A0200 anti-mouse CD86 Antibody

Pricing & Availability
Clone
GL-1 (See other available formats)
Regulatory Status
RUO
Other Names
B7-2, B70, Ly-58
Isotype
Rat IgG2a, κ
Barcode Sequence
CTGGATTTGTGTATC
Cat # Size Price Quantity Check Availability
105047 10 µg $369.00
Check Availability


Need larger quantities of this item?
Request Bulk Quote
Description

CD86 is an 80 kD immunoglobulin superfamily member also known as B7-2, B70, and Ly-58. CD86 is expressed on activated B and T cells, macrophages, dendritic cells, and astrocytes. CD86, along with CD80, is a ligand of CD28 and CD152 (CTLA-4). CD86 is expressed earlier in the immune response than CD80. CD86 has also been shown to be involved in immunoglobulin class-switching and triggering of NK cell-mediated cytotoxicity. CD86 binds to CD28 to transduce co-stimulatory signals for T cell activation, proliferation, and cytokine production. CD86 can also bind to CD152, also known as CTLA-4, to deliver an inhibitory signal to T cells.

Technical data sheet

Product Details

Verified Reactivity
Mouse
Antibody Type
Monoclonal
Host Species
Rat
Immunogen
LPS-activated CBA/Ca mouse splenic B cells
Formulation
Phosphate-buffered solution, pH 7.2, containing 0.09% sodium azide and EDTA
Preparation
The antibody was purified by chromatography and conjugated with TotalSeq™-A oligomer under optimal conditions.
Concentration
0.5 mg/ml
Storage & Handling
The antibody solution should be stored undiluted between 2°C and 8°C. Do not freeze.
Application

PG - Quality tested

Recommended Usage

Each lot of this antibody is quality control tested by immunofluorescent staining with flow cytometric analysis and the oligomer sequence is confirmed by sequencing. TotalSeq™-A antibodies are compatible with 10x Genomics Single Cell Gene Expression Solutions.

To maximize performance, it is strongly recommended that the reagent be titrated for each application, and that you centrifuge the antibody dilution before adding to the cells at 14,000xg at 2 - 8°C for 10 minutes. Carefully pipette out the liquid avoiding the bottom of the tube and add to the cell suspension. For Proteogenomics analysis, the suggested starting amount of this reagent for titration is ≤ 1.0 µg per million cells in 100 µL volume. Refer to the corresponding TotalSeq™ protocol for specific staining instructions.


Buyer is solely responsible for determining whether Buyer has all intellectual property rights that are necessary for Buyer's intended uses of the BioLegend TotalSeq™ products. For example, for any technology platform Buyer uses with TotalSeq™, it is Buyer's sole responsibility to determine whether it has all necessary third party intellectual property rights to use that platform and TotalSeq™ with that platform.
Application Notes

The GL-1 antibody can block the mixed lymphocyte reaction in vitro and has been shown to inhibit the priming of cytotoxic T lymphocytes in vivo (along with antibodies against B7-1). Additional reported applications (for the relevant formats) include: immunoprecipitation1, immunohistochemical staining of acetone-fixed frozen sections2,6, immunofluorescence microscopy, and in vivo and in vitro blocking of T cell responses1-6. GL-1 is not suitable for immunohistochemical staining of formalin-fixed paraffin sections. The Ultra-LEAF™ purified antibody (Endotoxin < 0.01 EU/µg, Azide-Free, 0.2 µm filtered) is recommended for functional assays (Cat. No. 105051-105056).

Additional Product Notes

TotalSeq™ reagents are designed to profile protein levels at a single cell level following an optimized protocol similar to the CITE-seq workflow. A compatible single cell device (e.g. 10x Genomics Chromium System and Reagents) and sequencer (e.g. Illumina analyzers) are required. Please contact technical support for more information, or visit biolegend.com/totalseq.

The barcode flanking sequences are CCTTGGCACCCGAGAATTCCA (PCR handle), and BAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA*A*A (capture sequence). B represents either C, G, or T, and * indicates a phosphorothioated bond, to prevent nuclease degradation.

View more applications data for this product in our Scientific Poster Library.

Application References

(PubMed link indicates BioLegend citation)
  1. Hathcock KS, et al. 1993. Science 262:905. (Block, IP)
  2. Inaba KM, et al. 1994. J. Exp. Med. 180:1849. (Block, IHC)
  3. Hathcock KS, et al. 1994. J. Exp. Med. 180:631. (Block)
  4. Krummel MF, et al. 1995. J. Exp. Med. 182:459. (Block)
  5. Liu Y, et al. 1997. J. Exp. Med. 185:251. (Block)
  6. Herold KC, et al. 1997. J. Immunol. 158:984. (Block, IHC)
  7. Shih FF, et al. 2006. J. Immunol. 176:3438. (FC)
  8. Lawson BR, et al. 2007. J. Immunol. 178:5366.
  9. Turnquist HR, et al. 2007. J. Immunol. 178:7018.
  10. Klinger MB, et al. 2007. Am. J. Physiol. Requl. Integr. Comp. Physiol. 293:R677. PubMed
  11. de Verteuil DA, et al. 2014. J Immunol. 193:1121. PubMed
Product Citations
  1. Al-Rifai R, et al. 2022. Nat Commun. 13:6592. PubMed
  2. Golomb SM, et al. 2020. Cell Rep. 33:108438. PubMed
  3. Guldner IH, et al. 2020. Cell. 183(5):1234-1248.e25. PubMed
  4. Wirka RC, et al. 2019. Nat Med. 25:1280. PubMed
  5. Guldner IH, et al. 2021. STAR Protocols. 2(2):100537. PubMed
  6. Pisu D, et al. 2021. J Exp Med. 218:. PubMed
RRID
AB_2750348 (BioLegend Cat. No. 105047)

Antigen Details

Structure
Ig superfamily, 80 kD
Distribution

B cells and T cells (upregulated upon activation), macrophages, dendritic cells, and astrocytes

Function
T cell costimulation, Ig class-switching, NK cell cytotoxicity
Ligand/Receptor
CD28, CD152 (CTLA-4)
Cell Type
Astrocytes, B cells, Dendritic cells, Macrophages, T cells, Tregs
Biology Area
Cell Biology, Costimulatory Molecules, Immunology, Neuroscience, Neuroscience Cell Markers
Molecular Family
CD Molecules, Immune Checkpoint Receptors
Antigen References

1. Barclay A, et al. 1997. The Leukocyte Antigen FactsBook Academic Press.
2. Hathcock KS, et al. 1993. Science 262:905.
3. Freeman GJ, et al. 1993. Science 262:907.
4. Carreno BM, et al. 2002. Annu. Rev. Immunol. 20:29.

Gene ID
12524 View all products for this Gene ID
UniProt
View information about CD86 on UniProt.org
Go To Top Version: 1    Revision Date: 08/31/2018

8999 BioLegend Way, San Diego, CA 92121 www.biolegend.com
Toll-Free Phone: 1-877-Bio-Legend (246-5343) Phone: (858) 768-5800 Fax: (877) 455-9587

This data display is provided for general comparisons between formats.
Your actual data may vary due to variations in samples, target cells, instruments and their settings, staining conditions, and other factors.
If you need assistance with selecting the best format contact our expert technical support team.

Login/Register
Forgot your password? Reset Password
Request an Account