TotalSeq™-A0202 anti-mouse CD64 (FcγRI) Antibody

Pricing & Availability
Clone
X54-5/7.1 (See other available formats)
Regulatory Status
RUO
Other Names
FcRI
Isotype
Mouse IgG1, κ
Barcode Sequence
AGCAATTAACGGGAG
Compare all formats
Cat # Size Price Quantity Check Availability
139325 10 µg $369.00
Check Availability


Need larger quantities of this item?
Request Bulk Quote
Description

CD64 is a 72 kD single chain type I glycoprotein also known as FcγRI and FcRI. CD64 is a member of the immunoglobulin superfamily and is expressed on monocytes/macrophages, dendritic cells, and mast cells. The expression can be upregulated by IFN-γ stimulation. CD64 binds IgG immune complex. It plays a role in antigen capture, phagocytosis of IgG/antigen complexes, and antibody-dependent cellular cytotoxicity (ADCC).

Technical data sheet

Product Details

Verified Reactivity
Mouse
Antibody Type
Monoclonal
Host Species
Mouse
Immunogen
BALB/c mouse FcγRI-human IgG Fc fusion protein.
Formulation
Phosphate-buffered solution, pH 7.2, containing 0.09% sodium azide and EDTA
Preparation
The antibody was purified by chromatography and conjugated with TotalSeq™-A oligomer under optimal conditions.
Concentration
0.5 mg/ml
Storage & Handling
The antibody solution should be stored undiluted between 2°C and 8°C. Do not freeze.
Application

PG - Quality tested
Recommended Usage

Each lot of this antibody is quality control tested by immunofluorescent staining with flow cytometric analysis and the oligomer sequence is confirmed by sequencing. TotalSeq™-A antibodies are compatible with 10x Genomics Single Cell Gene Expression Solutions.

To maximize performance, it is strongly recommended that the reagent be titrated for each application, and that you centrifuge the antibody dilution before adding to the cells at 14,000xg at 2 - 8°C for 10 minutes. Carefully pipette out the liquid avoiding the bottom of the tube and add to the cell suspension. For Proteogenomics analysis, the suggested starting amount of this reagent for titration is ≤ 1.0 µg per million cells in 100 µL volume. Refer to the corresponding TotalSeq™ protocol for specific staining instructions.


Buyer is solely responsible for determining whether Buyer has all intellectual property rights that are necessary for Buyer's intended uses of the BioLegend TotalSeq™ products. For example, for any technology platform Buyer uses with TotalSeq™, it is Buyer's sole responsibility to determine whether it has all necessary third party intellectual property rights to use that platform and TotalSeq™ with that platform.
Application Notes

The X54-5/7.1 antibody reacts with mouse strains carrying CD64a and b alleles but not CD64d. X54-5/7.1 recognizes a conformational determinant formed between domains 2 and 3. Additional reported application (for relevant formats) include: immunoprecipitation1, and spatial biology (IBEX)5,6. Clone X54-5/7.1 is not found to be useful for Western blots1.

Additional Product Notes

TotalSeq™ reagents are designed to profile protein levels at a single cell level following an optimized protocol similar to the CITE-seq workflow. A compatible single cell device (e.g. 10x Genomics Chromium System and Reagents) and sequencer (e.g. Illumina analyzers) are required. Please contact technical support for more information, or visit biolegend.com/totalseq.

The barcode flanking sequences are CCTTGGCACCCGAGAATTCCA (PCR handle), and BAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA*A*A (capture sequence). B represents either C, G, or T, and * indicates a phosphorothioated bond, to prevent nuclease degradation.

View more applications data for this product in our Scientific Poster Library.

Application References

(PubMed link indicates BioLegend citation)
  1. Tan PS, et al. 2003. J. Immunol. 170:2549. (IP)
  2. Ingersoll MA, et al. 2010. Blood 115:e10. (FC)
  3. Ozeri E, et al. 2012. J. Immunol. 189:146. PubMed
  4. Richardson ML, et al. 2014. PLoS Negl Trop Dis. 8:2825. PubMed
  5. Radtke AJ, et al. 2020. Proc Natl Acad Sci U S A. 117:33455-65. (SB) PubMed
  6. Radtke AJ, et al. 2022. Nat Protoc. 17:378-401. (SB) PubMed
Product Citations
  1. Kedmi R, et al. 2022. Nature. 610:737. PubMed
  2. Al-Rifai R, et al. 2022. Nat Commun. 13:6592. PubMed
  3. Golomb SM, et al. 2020. Cell Rep. 33:108438. PubMed
  4. Wirka RC, et al. 2019. Nat Med. 25:1280. PubMed
  5. Pisu D, et al. 2021. J Exp Med. 218:. PubMed
RRID
AB_2750367 (BioLegend Cat. No. 139325)

Antigen Details

Structure
Ig superfamily, type I glycoprotein, 72 kD
Distribution

Monocytes, macrophages, mast cells, dendritic cells

Function
Phagocytosis, ADCC
Ligand/Receptor
IgG
Cell Type
Dendritic cells, Macrophages, Mast cells, Monocytes
Biology Area
Immunology, Innate Immunity
Molecular Family
CD Molecules, Fc Receptors
Gene ID
14129 View all products for this Gene ID
UniProt
View information about CD64 on UniProt.org
Go To Top Version: 2    Revision Date: 12/14/2021

8999 BioLegend Way, San Diego, CA 92121 www.biolegend.com
Toll-Free Phone: 1-877-Bio-Legend (246-5343) Phone: (858) 768-5800 Fax: (877) 455-9587

This data display is provided for general comparisons between formats.
Your actual data may vary due to variations in samples, target cells, instruments and their settings, staining conditions, and other factors.
If you need assistance with selecting the best format contact our expert technical support team.

Login/Register
Forgot your password? Reset Password
Request an Account