- Clone
- 11C1 (See other available formats)
- Regulatory Status
- RUO
- Other Names
- TNFRSF13C, BAFF-R, BAFFR, BR3, BAFF Receptor
- Isotype
- Mouse IgG1, κ
- Barcode Sequence
- CGAAGTCGATCCGTA
Cat # | Size | Price | Quantity Check Availability | ||
---|---|---|---|---|---|
316925 | 10 µg | $369.00 |
B cell-activating factor receptor (BAFF-R) is a 19 kD type III membrane protein. It belongs to TNFR superfamily, also known as TNFRSF member 13C (TNFRSF13C), BAFF receptor 3 (BR3), or CD268. BAFF-R is expressed on mature B cells, B cell lymphoma, and T cell subset. BAFF-R is the major receptor for BAFF/BLys (or TALL-1, THANK) which binds to TACI and BCMA as well. The interaction of BAFF with BAFF-R promotes NF-κB activation and plays predominant roles in B-cell maturation and survival as well as costimulates T cell activation and proliferation. TRAF3 is a BAFF-R intracellularly associated protein, which negatively regulates BAFF-R-mediated NF-κB activation.
Product Details
- Verified Reactivity
- Human
- Reported Reactivity
- African Green, Baboon, Cynomolgus, Rhesus
- Antibody Type
- Monoclonal
- Host Species
- Mouse
- Immunogen
- BAFF-R-L1.2 transfectants
- Formulation
- Phosphate-buffered solution, pH 7.2, containing 0.09% sodium azide and EDTA
- Preparation
- The antibody was purified by chromatography and conjugated with TotalSeq™-A oligomer under optimal conditions.
- Concentration
- 0.5 mg/ml
- Storage & Handling
- The antibody solution should be stored undiluted between 2°C and 8°C. Do not freeze.
- Application
-
PG - Quality tested
- Recommended Usage
-
Each lot of this antibody is quality control tested by immunofluorescent staining with flow cytometric analysis and the oligomer sequence is confirmed by sequencing. TotalSeq™-A antibodies are compatible with 10x Genomics Single Cell Gene Expression Solutions.
To maximize performance, it is strongly recommended that the reagent be titrated for each application, and that you centrifuge the antibody dilution before adding to the cells at 14,000xg at 2 - 8°C for 10 minutes. Carefully pipette out the liquid avoiding the bottom of the tube and add to the cell suspension. For Proteogenomics analysis, the suggested starting amount of this reagent for titration is ≤ 1.0 µg per million cells in 100 µL volume. Refer to the corresponding TotalSeq™ protocol for specific staining instructions.
Buyer is solely responsible for determining whether Buyer has all intellectual property rights that are necessary for Buyer's intended uses of the BioLegend TotalSeq™ products. For example, for any technology platform Buyer uses with TotalSeq™, it is Buyer's sole responsibility to determine whether it has all necessary third party intellectual property rights to use that platform and TotalSeq™ with that platform. - Additional Product Notes
-
TotalSeq™ reagents are designed to profile protein levels at a single cell level following an optimized protocol similar to the CITE-seq workflow. A compatible single cell device (e.g. 10x Genomics Chromium System and Reagents) and sequencer (e.g. Illumina analyzers) are required. Please contact technical support for more information, or visit biolegend.com/totalseq.
The barcode flanking sequences are CCTTGGCACCCGAGAATTCCA (PCR handle), and BAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA*A*A (capture sequence). B represents either C, G, or T, and * indicates a phosphorothioated bond, to prevent nuclease degradation.
View more applications data for this product in our Scientific Poster Library. -
Application References
(PubMed link indicates BioLegend citation) -
- Ng LG, et al.2004. J. Immunol. 173:807. (FC IHC)
- Personal communication. (Block)
- Product Citations
-
- RRID
-
AB_2750502 (BioLegend Cat. No. 316925)
Antigen Details
- Structure
- Type III transmembrane protein, TNF receptor superfamily, 19 kD
- Distribution
-
Mature B cells, B cell lymphoma, T cell subset
- Function
- Induce B cell proliferation and immunoglobulin secretion, costimulate T cell activation
- Ligand/Receptor
- BAFF/BLys, associate with TRAF3
- Cell Type
- B cells, Leukemia, T cells
- Biology Area
- Immunology
- Molecular Family
- CD Molecules
- Antigen References
-
1. Thompson JS, et al. 2001. Science 293:2108.
2. Ng LG, et al.2004. J. Immunol. 173:807.
3. Rodig SJ, et al. 2005. Human Pathol. 36:1113.
4. Ye Q, et al. 2004. Eur. J. Immunol. 34:2750.
5. Kayagaki N, et al. 2002 Immunity 17:515. - Gene ID
- 115650 View all products for this Gene ID
- UniProt
- View information about CD268 on UniProt.org
Other Formats
View All CD268 Reagents Request Custom ConjugationDescription | Clone | Applications |
---|---|---|
Purified anti-human CD268 (BAFF-R) | 11C1 | FC,IHC-P |
FITC anti-human CD268 (BAFF-R) | 11C1 | FC |
PE anti-human CD268 (BAFF-R) | 11C1 | FC |
APC/Cyanine7 anti-human CD268 (BAFF-R) | 11C1 | FC |
Alexa Fluor® 647 anti-human CD268 (BAFF-R, BAFFR) | 11C1 | FC |
APC anti-human CD268 (BAFF-R, BAFFR) | 11C1 | FC |
PerCP/Cyanine5.5 anti-human CD268 (BAFF-R) | 11C1 | FC |
PE/Cyanine7 anti-human CD268 (BAFF-R) | 11C1 | FC |
PE/Dazzle™ 594 anti-human CD268 (BAFF-R) | 11C1 | FC |
Biotin anti-human CD268 (BAFF-R) | 11C1 | FC |
TotalSeq™-A0215 anti-human CD268 (BAFF-R) | 11C1 | PG |
TotalSeq™-C0215 anti-human CD268 (BAFF-R) | 11C1 | PG |
TotalSeq™-B0215 anti-human CD268 (BAFF-R) | 11C1 | PG |
Brilliant Violet 421™ anti-human CD268 (BAFF-R) | 11C1 | FC |
Compare Data Across All Formats
This data display is provided for general comparisons between formats.
Your actual data may vary due to variations in samples, target cells, instruments and their settings, staining conditions, and other factors.
If you need assistance with selecting the best format contact our expert technical support team.
-
Purified anti-human CD268 (BAFF-R)
-
FITC anti-human CD268 (BAFF-R)
-
PE anti-human CD268 (BAFF-R)
-
APC/Cyanine7 anti-human CD268 (BAFF-R)
-
Alexa Fluor® 647 anti-human CD268 (BAFF-R, BAFFR)
-
APC anti-human CD268 (BAFF-R, BAFFR)
-
PerCP/Cyanine5.5 anti-human CD268 (BAFF-R)
-
PE/Cyanine7 anti-human CD268 (BAFF-R)
-
PE/Dazzle™ 594 anti-human CD268 (BAFF-R)
-
Biotin anti-human CD268 (BAFF-R)
-
TotalSeq™-A0215 anti-human CD268 (BAFF-R)
-
TotalSeq™-C0215 anti-human CD268 (BAFF-R)
-
TotalSeq™-B0215 anti-human CD268 (BAFF-R)
-
Brilliant Violet 421™ anti-human CD268 (BAFF-R)