TotalSeq™-A0227 anti-mouse CD122 (IL-2Rβ) Antibody

Product Details

Verified Reactivity

Mouse

Antibody Type

Monoclonal

Host Species

Rat

Immunogen

Rat myeloma YB2/0 transfected with truncated mouse Il-2Rβ cDNA

Formulation

Phosphate-buffered solution, pH 7.2, containing 0.09% sodium azide and EDTA

Preparation

The antibody was purified by chromatography and conjugated with TotalSeq™-A oligomer under optimal conditions.

Concentration

0.5 mg/mL

Storage & Handling

The antibody solution should be stored undiluted between 2°C and 8°C. Do not freeze.

Application

PG - Quality tested

Recommended Usage

Each lot of this antibody is quality control tested by immunofluorescent staining with flow cytometric analysis and the oligomer sequence is confirmed by sequencing. TotalSeq™-A antibodies are compatible with 10x Genomics Single Cell Gene Expression Solutions.

To maximize performance, it is strongly recommended that the reagent be titrated for each application, and that you centrifuge the antibody dilution before adding to the cells at 14,000xg at 2 - 8°C for 10 minutes. Carefully pipette out the liquid avoiding the bottom of the tube and add to the cell suspension. For Proteogenomics analysis, the suggested starting amount of this reagent for titration is ≤ 1.0 µg per million cells in 100 µL volume. Refer to the corresponding TotalSeq™ protocol for specific staining instructions.

Buyer is solely responsible for determining whether Buyer has all intellectual property rights that are necessary for Buyer's intended uses of the BioLegend TotalSeq™ products. For example, for any technology platform Buyer uses with TotalSeq™, it is Buyer's sole responsibility to determine whether it has all necessary third party intellectual property rights to use that platform and TotalSeq™ with that platform.

Application Notes

Additional reported applications (for the relevant formats) include: immunoprecipitation^1,2.

Additional Product Notes

TotalSeq™ reagents are designed to profile protein levels at a single cell level following an optimized protocol similar to the CITE-seq workflow. A compatible single cell device (e.g. 10x Genomics Chromium System and Reagents) and sequencer (e.g. Illumina analyzers) are required. Please contact technical support for more information, or visit biolegend.com/totalseq.

The barcode flanking sequences are CCTTGGCACCCGAGAATTCCA (PCR handle), and BAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA*A*A (capture sequence). B represents either C, G, or T, and * indicates a phosphorothioated bond, to prevent nuclease degradation.

View more applications data for this product in our Scientific Poster Library.

Application References

(PubMed link indicates BioLegend citation)

1. Furse R, et al. 1993 Eur. J. Immunol. 23:3181. (IP)
2. He YW, et al. 1995. J. Immunol. 154:1596. (IP)
3. Liqons DL, et al. 2012. J Biol Chem. 287:34386. PubMed.

RRID

AB_3068030 (BioLegend Cat. No. 105909)

Antigen Details

Structure

Ig superfamily, forms high affinity IL-2 receptor with CD25 and CD132 chains or intermediate affinity receptor with CD132 alone, 70-75 kD

Distribution

T cells and B cells, NK cells, monocytes, macrophages

Function

Critical component of IL-2 and IL-15 signaling

Ligand/Receptor

IL-2, IL-15

Cell Type

B cells, Macrophages, Monocytes, NK cells, T cells, Tregs

Biology Area

Immunology

Molecular Family

CD Molecules, Cytokine/Chemokine Receptors

Antigen References

1. Barclay A, et al. 1997. The Leukocyte Antigen FactsBook Academic Press.
2. Minami Y, et al. 1993. Annu. Rev. Immunol. 11:245.
3. Suzuki H, et al. 1995. Science 268:1472.
4. Shi Z, et al. 2009. Eur. J. Immunol. 39:2109.

Gene ID

16185 View all products for this Gene ID

UniProt

View information about CD122 on UniProt.org

Related Protocols

• TotalSeq™-A Antibodies and Cell Hashing with 10x Single Cell 3' Reagent Kit v3 3.1 Protocol

Other Formats