TotalSeq™-A0247 anti-human CD267 (TACI) Antibody

Pricing & Availability
Clone
1A1 (See other available formats)
Regulatory Status
RUO
Other Names
TNFRSF13B, CD267, Transmembrane Activator and CAML Interactor (TACI)
Isotype
Rat IgG2a, κ
Barcode Sequence
AGTGATGGAGCGAAC
Cat # Size Price Quantity Check Availability
311913 10 µg $369.00
Check Availability


Need larger quantities of this item?
Request Bulk Quote
Description

TACI, Transmembrane Activator CAML (calcium modulator and cyclophilin ligand) Interactor, is a 32 kD type III transmembrane protein. It belongs to TNF receptor superfamily, known as TNFRSF member 13B (TNFRSF13B) or CD267. TACI is expressed on B cells, and myeloma cells. TACI contains 2 cysteine-rich domains (CRDs). Recent studies, however, have shown that another shorter form (TACI_d2) of TACI exists wherein the N-terminal CRD is removed by alternative splicing. TACI_d2 contains full affinity for its ligands. Several proteins (BAFF/BLys, APRIL, Syndecan-2) have been identified as TACI ligands. The interaction of TACI with its ligands induces activation of the transcription factors NFAT, AP1, and NF-κ B and plays a crucial role in humoral immunity by negative regulation of B cell proliferation and survival.

Technical data sheet

Product Details

Verified Reactivity
Human
Reported Reactivity
African Green, Baboon, Cynomolgus, Rhesus
Antibody Type
Monoclonal
Host Species
Rat
Immunogen
TACI-transfected RBL cells
Formulation
Phosphate-buffered solution, pH 7.2, containing 0.09% sodium azide and EDTA
Preparation
The antibody was purified by chromatography and conjugated with TotalSeq™-A oligomer under optimal conditions.
Concentration
0.5 mg/ml
Storage & Handling
The antibody solution should be stored undiluted between 2°C and 8°C. Do not freeze.
Application

PG - Quality tested

Recommended Usage

Each lot of this antibody is quality control tested by immunofluorescent staining with flow cytometric analysis and the oligomer sequence is confirmed by sequencing. TotalSeq™-A antibodies are compatible with 10x Genomics Single Cell Gene Expression Solutions.

To maximize performance, it is strongly recommended that the reagent be titrated for each application, and that you centrifuge the antibody dilution before adding to the cells at 14,000xg at 2 - 8°C for 10 minutes. Carefully pipette out the liquid avoiding the bottom of the tube and add to the cell suspension. For Proteogenomics analysis, the suggested starting amount of this reagent for titration is ≤ 1.0 µg per million cells in 100 µL volume. Refer to the corresponding TotalSeq™ protocol for specific staining instructions.


Buyer is solely responsible for determining whether Buyer has all intellectual property rights that are necessary for Buyer's intended uses of the BioLegend TotalSeq™ products. For example, for any technology platform Buyer uses with TotalSeq™, it is Buyer's sole responsibility to determine whether it has all necessary third party intellectual property rights to use that platform and TotalSeq™ with that platform.
Additional Product Notes

TotalSeq™ reagents are designed to profile protein levels at a single cell level following an optimized protocol similar to the CITE-seq workflow. A compatible single cell device (e.g. 10x Genomics Chromium System and Reagents) and sequencer (e.g. Illumina analyzers) are required. Please contact technical support for more information, or visit biolegend.com/totalseq.

The barcode flanking sequences are CCTTGGCACCCGAGAATTCCA (PCR handle), and BAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA*A*A (capture sequence). B represents either C, G, or T, and * indicates a phosphorothioated bond, to prevent nuclease degradation.

View more applications data for this product in our Scientific Poster Library.

Application References

(PubMed link indicates BioLegend citation)
  1. Ng LG, et al.2004. J. Immunol. 173:807. (FC)
  2. Lougaris V, et al. 2012. Hum Immunol. 73:836. PubMed.
Product Citations
  1. Hao Y, et al. 2021. Cell. 184:3573. PubMed
RRID
AB_2783181 (BioLegend Cat. No. 311913)

Antigen Details

Structure
Type III transmembrane protein, TNF receptor superfamily, 32 kD
Distribution

B cells, meyloma cells

Function
Negative regulation of B cell function
Ligand/Receptor
BAFF/BLys, April, Syndecan-2
Cell Type
B cells
Biology Area
Costimulatory Molecules, Immunology
Molecular Family
CD Molecules
Antigen References

1. Gross JA, et al. 2000. Nature 404:995.
2. Wu Y, et al. 2000. J. Biol Chem. 275:35478.
3. Yan M, et al. 2001. Nat. Immunol. 2:638.
4. Hymowitz A, et al. 2005. J. Biol. Chem. 280:7218.
5. Bischof D, et al. 2006. BLOOD 107:3235.

Gene ID
23495 View all products for this Gene ID
UniProt
View information about CD267 on UniProt.org
Go To Top Version: 1    Revision Date: 12/05/2018

8999 BioLegend Way, San Diego, CA 92121 www.biolegend.com
Toll-Free Phone: 1-877-Bio-Legend (246-5343) Phone: (858) 768-5800 Fax: (877) 455-9587

This data display is provided for general comparisons between formats.
Your actual data may vary due to variations in samples, target cells, instruments and their settings, staining conditions, and other factors.
If you need assistance with selecting the best format contact our expert technical support team.

Login/Register
Forgot your password? Reset Password
Request an Account