TotalSeq™-A0410 anti-human CD38 Antibody

Pricing & Availability
Clone
HB-7 (See other available formats)
Regulatory Status
RUO
Workshop
III 155
Other Names
HB7, T10, ADP-ribosyl cyclase
Isotype
Mouse IgG1, κ
Barcode Sequence
CCTATTCCGATTCCG
Compare all formats
Cat # Size Price Quantity Check Availability
356635 10 µg $369.00
Check Availability


Need larger quantities of this item?
Request Bulk Quote
Description

CD38 is a 45 kD type II transmembrane glycoprotein also known as T10. It is an ADP-ribosyl hydrolase expressed at variable levels on hematopoietic cells and in some non-hematopoietic tissues (such as brain, muscle, and kidney). In humans, it is expressed at high levels on plasma cells and activated T and B cells, natural killer (NK) lymphocytes, myeloblasts, and erythroblasts. By functioning as both a cyclase and a hydrolase, CD38 mediates lymphocyte activation, adhesion, and the metabolism of cADPR and NAADP. CD31 is the ligand of CD38.

Technical data sheet

Product Details

Verified Reactivity
Human
Antibody Type
Monoclonal
Host Species
Mouse
Immunogen
BJAB human B cell line.
Formulation
Phosphate-buffered solution, pH 7.2, containing 0.09% sodium azide and EDTA
Preparation
The antibody was purified by chromatography and conjugated with TotalSeq™-A oligomer under optimal conditions.
Concentration
0.5 mg/ml
Storage & Handling
The antibody solution should be stored undiluted between 2°C and 8°C. Do not freeze.
Application

PG - Quality tested
Recommended Usage

Each lot of this antibody is quality control tested by immunofluorescent staining with flow cytometric analysis and the oligomer sequence is confirmed by sequencing. TotalSeq™-A antibodies are compatible with 10x Genomics Single Cell Gene Expression Solutions.

To maximize performance, it is strongly recommended that the reagent be titrated for each application, and that you centrifuge the antibody dilution before adding to the cells at 14,000xg at 2 - 8°C for 10 minutes. Carefully pipette out the liquid avoiding the bottom of the tube and add to the cell suspension. For Proteogenomics analysis, the suggested starting amount of this reagent for titration is ≤ 1.0 µg per million cells in 100 µL volume. Refer to the corresponding TotalSeq™ protocol for specific staining instructions.


Buyer is solely responsible for determining whether Buyer has all intellectual property rights that are necessary for Buyer's intended uses of the BioLegend TotalSeq™ products. For example, for any technology platform Buyer uses with TotalSeq™, it is Buyer's sole responsibility to determine whether it has all necessary third party intellectual property rights to use that platform and TotalSeq™ with that platform.
Additional Product Notes

TotalSeq™ reagents are designed to profile protein levels at a single cell level following an optimized protocol similar to the CITE-seq workflow. A compatible single cell device (e.g. 10x Genomics Chromium System and Reagents) and sequencer (e.g. Illumina analyzers) are required. Please contact technical support for more information, or visit biolegend.com/totalseq.

The barcode flanking sequences are CCTTGGCACCCGAGAATTCCA (PCR handle), and BAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA*A*A (capture sequence). B represents either C, G, or T, and * indicates a phosphorothioated bond, to prevent nuclease degradation.

View more applications data for this product in our Scientific Poster Library.

Product Citations
  1. Carratt SA, et al. 2022. Blood. 140:644. PubMed
  2. Swanson E, et al. 2021. eLife. 10:00. PubMed
  3. Hao Y, et al. 2021. Cell. 184:3573. PubMed
RRID
AB_2800967 (BioLegend Cat. No. 356635)

Antigen Details

Structure
ADP-ribosyl cyclase, ectoenzyme, type II glycoprotein, 45 kD
Distribution

T cells, B cells, NK-cells, myeloid, plasma, and dendritic cells

Function
Ecto-ADP-ribosyl cyclase, calcium signaling, cell activation
Ligand/Receptor
CD31, hyaluronic acid
Cell Type
B cells, Dendritic cells, NK cells, Plasma cells, T cells
Biology Area
Cell Adhesion, Cell Biology, Immunology
Molecular Family
Adhesion Molecules, CD Molecules
Antigen References

1. Ferrero E, et al. 1999. J. Leukoc. Biol. 65:151.
2. Lund F, et al. 1995. Immunol. Today 16:469.

Gene ID
952 View all products for this Gene ID
UniProt
View information about CD38 on UniProt.org
Go To Top Version: 1    Revision Date: 01/02/2019

8999 BioLegend Way, San Diego, CA 92121 www.biolegend.com
Toll-Free Phone: 1-877-Bio-Legend (246-5343) Phone: (858) 768-5800 Fax: (877) 455-9587

This data display is provided for general comparisons between formats.
Your actual data may vary due to variations in samples, target cells, instruments and their settings, staining conditions, and other factors.
If you need assistance with selecting the best format contact our expert technical support team.

Login/Register
Forgot your password? Reset Password
Request an Account