TotalSeq™-A0419 anti-human CD72 Antibody

Pricing & Availability
Clone
3F3 (See other available formats)
Regulatory Status
RUO
Workshop
VI CD72.1
Other Names
Lyb-2, Ly-19.2, Ly-32.2
Isotype
Mouse IgG2b, κ
Barcode Sequence
CAGTCGTGGTAGATA
Compare all formats
Cat # Size Price Quantity Check Availability
316205 10 µg $369.00
Check Availability


Need larger quantities of this item?
Request Bulk Quote
Description

CD72 is a 39-43 kD type II membrane glycoprotein. It is a disulfide-linked homodimer belonging to C-type lectin family. CD72 is a pan-B cell marker expressed on pre-pre-B cells throughout B cell differentiation with the exception of plasma cells. It is also expressed on follicular dendritic cells, splenic red pulp macrophages (but not on peripheral blood monocytes), and liver Kupffer cells. CD72, a negative coreceptor of B cells, contains immunoreceptor tyrosine-based inhibitory motifs in the cytoplasmic domain which has been shown to recruit the tyrosine phosphatase SHP-1. Ligation of CD72 with its ligand regulates CD72 tyrosine dephosphorylation and SHP-1 dissociation to promote B cell activation and proliferation. CD100 and CD5 have been shown to be CD72 ligands. The CD100-CD72 interaction plays a role in maintenance of B cell homeostasis.

Technical data sheet

Product Details

Verified Reactivity
Human
Antibody Type
Monoclonal
Host Species
Mouse
Immunogen
Human lymphocytes
Formulation
Phosphate-buffered solution, pH 7.2, containing 0.09% sodium azide and EDTA
Preparation
The antibody was purified by chromatography and conjugated with TotalSeq™-A oligomer under optimal conditions.
Concentration
0.5 mg/ml
Storage & Handling
The antibody solution should be stored undiluted between 2°C and 8°C. Do not freeze.
Application

PG - Quality tested
Recommended Usage

Each lot of this antibody is quality control tested by immunofluorescent staining with flow cytometric analysis and the oligomer sequence is confirmed by sequencing. TotalSeq™-A antibodies are compatible with 10x Genomics Single Cell Gene Expression Solutions.

To maximize performance, it is strongly recommended that the reagent be titrated for each application, and that you centrifuge the antibody dilution before adding to the cells at 14,000xg at 2 - 8°C for 10 minutes. Carefully pipette out the liquid avoiding the bottom of the tube and add to the cell suspension. For Proteogenomics analysis, the suggested starting amount of this reagent for titration is ≤ 1.0 µg per million cells in 100 µL volume. Refer to the corresponding TotalSeq™ protocol for specific staining instructions.


Buyer is solely responsible for determining whether Buyer has all intellectual property rights that are necessary for Buyer's intended uses of the BioLegend TotalSeq™ products. For example, for any technology platform Buyer uses with TotalSeq™, it is Buyer's sole responsibility to determine whether it has all necessary third party intellectual property rights to use that platform and TotalSeq™ with that platform.
Application Notes

Additional reported applications (for the relevant formats) include: immunoprecipitation.

Additional Product Notes

TotalSeq™ reagents are designed to profile protein levels at a single cell level following an optimized protocol similar to the CITE-seq workflow. A compatible single cell device (e.g. 10x Genomics Chromium System and Reagents) and sequencer (e.g. Illumina analyzers) are required. Please contact technical support for more information, or visit biolegend.com/totalseq.

The barcode flanking sequences are CCTTGGCACCCGAGAATTCCA (PCR handle), and BAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA*A*A (capture sequence). B represents either C, G, or T, and * indicates a phosphorothioated bond, to prevent nuclease degradation.

View more applications data for this product in our Scientific Poster Library.

Application References

(PubMed link indicates BioLegend citation)
  1. Knapp W, et al. Eds. 1989. Leucocyte Typing IV. Oxford University Press. New York.
Product Citations
  1. Salazar F, et al. 2017. Sci Rep. 7:43337. PubMed
  2. Hao Y, et al. 2021. Cell. 184:3573. PubMed
RRID
AB_2783189 (BioLegend Cat. No. 316205)

Antigen Details

Structure
Type II membrane glycoprotein, C-type lectin family, 39-43 kD, homodimer
Distribution

Pre-pre-B cells throughout B cells differentiation (but not on plasma cells), follicular dendritic cells, splenic red pulp macrophages, liver Kupffer cells

Function
negative regulation of B cell receptor signaling
Ligand/Receptor
CD5, CD100/Sema4D
Cell Type
B cells, Dendritic cells
Biology Area
Immunology
Molecular Family
CD Molecules
Antigen References
  1. Knapp W, et al. Eds. 1989. Leucocyte Typing IV. Oxford University Press. New York.
  2. Schwarting T, et al. 1992. Am. J. Hematol. 41:151.
  3. Wu HJ and S. Bondata. 2002. Immunol. Res. 25:155.
  4. Kumanogoh A, et al. 2000. Immunity 13:621.
  5. Parnes JR and C. Pan. 2000. Immunol. Rev. 176:75.
  6. Kumanogoh A, et al. 2005. Intnl. Immunol. 17:1277.
Gene ID
971 View all products for this Gene ID
UniProt
View information about CD72 on UniProt.org
Go To Top Version: 1    Revision Date: 09/26/2018

8999 BioLegend Way, San Diego, CA 92121 www.biolegend.com
Toll-Free Phone: 1-877-Bio-Legend (246-5343) Phone: (858) 768-5800 Fax: (877) 455-9587

This data display is provided for general comparisons between formats.
Your actual data may vary due to variations in samples, target cells, instruments and their settings, staining conditions, and other factors.
If you need assistance with selecting the best format contact our expert technical support team.

Login/Register
Forgot your password? Reset Password
Request an Account