- Clone
- 15C4 (See other available formats)
- Regulatory Status
- RUO
- Other Names
- OLR1, LOX1, LOXIN, SLOX1, CLEC8A, SCARE1
- Isotype
- Mouse IgG2a, κ
- Barcode Sequence
- ACCCTTTACCGAATA
| Cat # | Size | Price | Quantity Check Availability | ||
|---|---|---|---|---|---|
| 358611 | 10 µg | $369.00 | |||
Lectin-like oxidized LDL receptor 1 (LOX-1) also known as CLEC8A is a 31 kD single pass type II transmembrane protein and member of the C-type lectin superfamily. LOX-1 is a scavenger receptor and is involved in endocytosis, phagocytosis and cytokine production. CLEC8A is expressed by endothelial cells, smooth muscle cells, platelets, fibroblasts, macrophages, and is upregulated by inflammatory and oxidative stimuli. LOX-1 recognizes numerous ligands including lipoproteins, apoptotic cells heat shock proteins, C-reactive protein and oxidized LDL. LOX-1 is implicated in atherosclerosis and vascular inflammation.
Product Details
- Verified Reactivity
- Human
- Antibody Type
- Monoclonal
- Host Species
- Mouse
- Immunogen
- LOX-1 ectodomain: Fc fusion protein
- Formulation
- Phosphate-buffered solution, pH 7.2, containing 0.09% sodium azide and EDTA
- Preparation
- The antibody was purified by chromatography and conjugated with TotalSeq™-C oligomer under optimal conditions.
- Concentration
- 0.5 mg/ml
- Storage & Handling
- The antibody solution should be stored undiluted between 2°C and 8°C. Do not freeze.
- Application
-
PG - Quality tested
- Recommended Usage
-
Each lot of this antibody is quality control tested by immunofluorescent staining with flow cytometric analysis and the oligomer sequence is confirmed by sequencing. TotalSeq™-A antibodies are compatible with 10x Genomics Single Cell Gene Expression Solutions.
To maximize performance, it is strongly recommended that the reagent be titrated for each application, and that you centrifuge the antibody dilution before adding to the cells at 14,000xg at 2 - 8°C for 10 minutes. Carefully pipette out the liquid avoiding the bottom of the tube and add to the cell suspension. For Proteogenomics analysis, the suggested starting amount of this reagent for titration is ≤ 1.0 µg per million cells in 100 µL volume. Refer to the corresponding TotalSeq™ protocol for specific staining instructions.
Buyer is solely responsible for determining whether Buyer has all intellectual property rights that are necessary for Buyer's intended uses of the BioLegend TotalSeq™ products. For example, for any technology platform Buyer uses with TotalSeq™, it is Buyer's sole responsibility to determine whether it has all necessary third party intellectual property rights to use that platform and TotalSeq™ with that platform. - Application Notes
-
Additional reported applications (for the relevant formats) include: immunofluorescent staining of acetone-fixed frozen human skin sections1.
- Additional Product Notes
-
TotalSeq™ reagents are designed to profile protein levels at a single cell level following an optimized protocol similar to the CITE-seq workflow. A compatible single cell device (e.g. 10x Genomics Chromium System and Reagents) and sequencer (e.g. Illumina analyzers) are required. Please contact technical support for more information, or visit biolegend.com/totalseq.
The barcode flanking sequences are CCTTGGCACCCGAGAATTCCA (PCR handle), and BAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA*A*A (capture sequence). B represents either C, G, or T, and * indicates a phosphorothioated bond, to prevent nuclease degradation.
View more applications data for this product in our Scientific Poster Library. -
Application References
(PubMed link indicates BioLegend citation) -
- Li D, et al. 2012. J. Exp. Med. 209:109. (IHC)
- Product Citations
-
- RRID
-
AB_2800987 (BioLegend Cat. No. 358611)
Antigen Details
- Structure
- Single pass, type II, transmembrane protein, 31 kD, homodimer, member of the C-type lectin superfamily.
- Distribution
- Endothelial cells, smooth muscle, platelets, fibroblasts, macrophages; Upregulated by inflammatory and oxidative stimuli
- Function
- Scavenger receptor, involved in endocytosis, phagocytosis and cytokine production
- Ligand/Receptor
- Recognizes numerous ligands including lipoproteins, apoptotic cells, heat shock proteins, C-reactive protein, oxidized LDL
- Cell Type
- Endothelial cells, Platelets, Fibroblasts, Macrophages, Dendritic cells
- Biology Area
- Cell Adhesion, Cell Biology, Immunology, Innate Immunity
- Molecular Family
- Adhesion Molecules
- Antigen References
-
1. Yin Y, et al. 2013. Eur. J. Cell Biol. 92:150.
2. Khaidakov M. and Mehta JL. 2012. PLoS One. 7:e46973.
3. Sawamura T, et al. 2012. Curr. Opin. Lipidol. 23:439.
4. Lin FY, et al. 2011. J. Immunol. 186:4405.
5. Parlato S, et al. 2010. Blood 115:1554. - Gene ID
- 4973 View all products for this Gene ID
- UniProt
- View information about LOX-1 on UniProt.org
Other Formats
View All LOX-1 Reagents Request Custom Conjugation| Description | Clone | Applications |
|---|---|---|
| PE anti-human LOX-1 | 15C4 | FC |
| Purified anti-human LOX-1 | 15C4 | FC,IHC-F |
| APC anti-human LOX-1 | 15C4 | FC |
| Brilliant Violet 421™ anti-human LOX-1 | 15C4 | FC |
| TotalSeq™-A0591 anti-human LOX-1 | 15C4 | PG |
| TotalSeq™-C0591 anti-human LOX-1 | 15C4 | PG |
| TotalSeq™-B0591 anti-human LOX-1 Antibody | 15C4 | PG |
Compare Data Across All Formats
This data display is provided for general comparisons between formats.
Your actual data may vary due to variations in samples, target cells, instruments and their settings, staining conditions, and other factors.
If you need assistance with selecting the best format contact our expert technical support team.
-
PE anti-human LOX-1
GM-CSF-stimulated (3 days) human peripheral blood monocytes ... -
Purified anti-human LOX-1
GM-CSF-stimulated (3 days) human peripheral blood mononuclea... -
APC anti-human LOX-1
GM-CSF-stimulated (3 days) human peripheral blood monocytes ... -
Brilliant Violet 421™ anti-human LOX-1
GM-CSF-stimulated (3 days) human peripheral blood monocytes ... -
TotalSeq™-A0591 anti-human LOX-1
-
TotalSeq™-C0591 anti-human LOX-1
-
TotalSeq™-B0591 anti-human LOX-1 Antibody