TotalSeq™-A0595 anti-mouse CD11a Antibody

Product Details

Verified Reactivity

Mouse

Antibody Type

Monoclonal

Host Species

Rat

Immunogen

C57BL/6 mouse splenic secondary cytotoxic T cells

Formulation

Phosphate-buffered solution, pH 7.2, containing 0.09% sodium azide and EDTA

Preparation

The antibody was purified by chromatography and conjugated with TotalSeq™-A oligomer under optimal conditions.

Concentration

0.5 mg/ml

Storage & Handling

The antibody solution should be stored undiluted between 2°C and 8°C. Do not freeze.

Application

PG - Quality tested

Recommended Usage

Each lot of this antibody is quality control tested by immunofluorescent staining with flow cytometric analysis and the oligomer sequence is confirmed by sequencing. TotalSeq™-A antibodies are compatible with 10x Genomics Single Cell Gene Expression Solutions.

To maximize performance, it is strongly recommended that the reagent be titrated for each application, and that you centrifuge the antibody dilution before adding to the cells at 14,000xg at 2 - 8°C for 10 minutes. Carefully pipette out the liquid avoiding the bottom of the tube and add to the cell suspension. For Proteogenomics analysis, the suggested starting amount of this reagent for titration is ≤ 1.0 µg per million cells in 100 µL volume. Refer to the corresponding TotalSeq™ protocol for specific staining instructions.

Buyer is solely responsible for determining whether Buyer has all intellectual property rights that are necessary for Buyer's intended uses of the BioLegend TotalSeq™ products. For example, for any technology platform Buyer uses with TotalSeq™, it is Buyer's sole responsibility to determine whether it has all necessary third party intellectual property rights to use that platform and TotalSeq™ with that platform.

Application Notes

The M17/4 antibody can block CD11a-mediated cellular adhesion. Additional reported applications of this antibody (for the relevant formats) include: immunoprecipitation^1,2, in vitro blocking of cell-cell adhesion^1,2 and FOXP3 expression⁵, and immunohistochemical staining of acetone-fixed frozen sections³. The M17/4 antibody does not block the binding of 2D7 antibody (Cat. No. 101002) to CD11a. The LEAF™ purified antibody (Endotoxin <0.1 EU/µg, Azide-Free, 0.2 µm filtered) is recommended for functional assays (Cat. No. 101110). For in vivo studies or highly sensitive assays, we recommend Ultra-LEAF™ purified antibody (Cat. No. 101118) with a lower endotoxin limit than standard LEAF™ purified antibodies (Endotoxin <0.01 EU/µg).

Additional Product Notes

TotalSeq™ reagents are designed to profile protein levels at a single cell level following an optimized protocol similar to the CITE-seq workflow. A compatible single cell device (e.g. 10x Genomics Chromium System and Reagents) and sequencer (e.g. Illumina analyzers) are required. Please contact technical support for more information, or visit biolegend.com/totalseq.

The barcode flanking sequences are CCTTGGCACCCGAGAATTCCA (PCR handle), and BAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA*A*A (capture sequence). B represents either C, G, or T, and * indicates a phosphorothioated bond, to prevent nuclease degradation.

View more applications data for this product in our Scientific Poster Library.

Application References

(PubMed link indicates BioLegend citation)

1. Sanchez-Madrid F, et al. 1982. Cell Immunol. 73:1. (IP, Block)
2. Kuhlman P, et al. 1991. J. Immunol. 146:1773. (IP, Block)
3. Mizgerd JP, et al. 1997. J. Exp. Med. 186:1357. (IHC)
4. Hailman E and Allen PM. 2005. J. Immunol. 175:4847. (FC)
5. Verhagen J and Wraith DC. 2014. J. Immunol. Methods. S0022. (Block) PubMed

RRID

AB_2783036 (BioLegend Cat. No. 101125)

Antigen Details

Structure

Integrin family, associates with integrin β2 (CD18), 180 kD

Distribution

Lymphocytes, granulocytes, monocytes, macrophages

Function

Cellular adhesion

Ligand/Receptor

ICAM-1 (CD54), ICAM-2 (CD102), ICAM-3 (CD50)

Cell Type

Granulocytes, Lymphocytes, Macrophages, Monocytes, Tregs

Biology Area

Cell Adhesion, Cell Biology, Costimulatory Molecules, Immunology, Innate Immunity, Neuroinflammation, Neuroscience

Molecular Family

Adhesion Molecules, CD Molecules

Antigen References

1. Barclay A, et al. 1997. The Leukocyte Antigen FactsBook Academic Press.
2. Springer TA. 1994. Cell 76:301.
3. Lub M, et al. 1995. Immunol. Today 16:479.

Gene ID

16408 View all products for this Gene ID

UniProt

View information about CD11a on UniProt.org

Related Protocols

• TotalSeq™-A Antibodies and Cell Hashing with 10x Single Cell 3' Reagent Kit v3 3.1 Protocol

Other Formats