- Clone
- 927 (See other available formats)
- Regulatory Status
- RUO
- Other Names
- BST2, tetherin, HM1.2 antigen, bone marrow stromal antigen 2, PDCA-1
- Isotype
- Rat IgG2b, κ
- Barcode Sequence
- TGTGGTAGCCCTTGT
Cat # | Size | Price | Quantity Check Availability | ||
---|---|---|---|---|---|
127027 | 10 µg | $369.00 |
CD317, known as BST2, tetherin, HM1.2 antigen, bone marrow stromal antigen 2, or PDCA-1, is type II transmembrane glycoprotein with a molecular mass of 29-33 kD. It is predominantly expressed on Type I IFN-producing cells (IPCs) in naïve mice, but is up-regulated on most cell types following stimulation with type I IFNs and IFN-gamma. It is highly expressed on terminally differentiated normal plasmacytoid dendritic cells and some tumor cells, such as multiple myeloma, renal cell carcinoma, and melanoma cells. BST2 is a recently identified, IFN-induced cellular response factor that blocks release of HIV-1 and other retroviruses from infected cells. BST2 has been found to be the natural ligand of ILT7 in human model.
Product Details
- Verified Reactivity
- Mouse
- Antibody Type
- Monoclonal
- Host Species
- Rat
- Immunogen
- Mouse plasmacytoid dendritic cells (DCs)
- Formulation
- Phosphate-buffered solution, pH 7.2, containing 0.09% sodium azide and EDTA
- Preparation
- The antibody was purified by chromatography and conjugated with TotalSeq™-A oligomer under optimal conditions.
- Concentration
- 0.5 mg/ml
- Storage & Handling
- The antibody solution should be stored undiluted between 2°C and 8°C. Do not freeze.
- Application
-
PG - Quality tested
- Recommended Usage
-
Each lot of this antibody is quality control tested by immunofluorescent staining with flow cytometric analysis and the oligomer sequence is confirmed by sequencing. TotalSeq™-A antibodies are compatible with 10x Genomics Single Cell Gene Expression Solutions.
To maximize performance, it is strongly recommended that the reagent be titrated for each application, and that you centrifuge the antibody dilution before adding to the cells at 14,000xg at 2 - 8°C for 10 minutes. Carefully pipette out the liquid avoiding the bottom of the tube and add to the cell suspension. For Proteogenomics analysis, the suggested starting amount of this reagent for titration is ≤ 1.0 µg per million cells in 100 µL volume. Refer to the corresponding TotalSeq™ protocol for specific staining instructions.
Buyer is solely responsible for determining whether Buyer has all intellectual property rights that are necessary for Buyer's intended uses of the BioLegend TotalSeq™ products. For example, for any technology platform Buyer uses with TotalSeq™, it is Buyer's sole responsibility to determine whether it has all necessary third party intellectual property rights to use that platform and TotalSeq™ with that platform. - Application Notes
-
Additional reported applications (for the relevant formats) include: immunofluorescence microscopy, functional assay2, and depletion3,4. The Ultra-LEAF™ purified antibody (Endotoxin <0.01 EU/µg, Azide-Free, 0.2 µm filtered) is recommended for functional assays.
- Additional Product Notes
-
TotalSeq™ reagents are designed to profile protein levels at a single cell level following an optimized protocol similar to the CITE-seq workflow. A compatible single cell device (e.g. 10x Genomics Chromium System and Reagents) and sequencer (e.g. Illumina analyzers) are required. Please contact technical support for more information, or visit biolegend.com/totalseq.
The barcode flanking sequences are CCTTGGCACCCGAGAATTCCA (PCR handle), and BAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA*A*A (capture sequence). B represents either C, G, or T, and * indicates a phosphorothioated bond, to prevent nuclease degradation.
View more applications data for this product in our Scientific Poster Library. -
Application References
(PubMed link indicates BioLegend citation) -
- Blasius AL, et al. 2006. J. Immunol. 177:3260.
- Schliemann C, et al. 2010. Blood 115:736. (FA, IF)
- Rajagopal D, et al. 2010. Blood 115:1949. (Depletion)
- Moniz RJ, et al. 2010. FEMS Immunol. Med. Microbiol. 58:397. (Depletion)
- Chen YL, et al. 2013. J Exp Med. 210:2515. PubMed
- RRID
-
AB_2800623 (BioLegend Cat. No. 127027)
Antigen Details
- Structure
- Type II transmembrane glycoprotein with a molecular mass of 29-33 kD.
- Distribution
-
Expressed on type I IFN-producing cells, plasmacytoid dendritic cells, and neoplastic B cells, such as multiple myeloma.
- Function
- Recently identified antiviral protein that blocks the release of nascent retrovirus or other particles from infected cells.
- Cell Type
- Dendritic cells
- Biology Area
- Costimulatory Molecules, Immunology, Innate Immunity
- Molecular Family
- CD Molecules
- Antigen References
-
1. Douglas JL. et al. 2009. J Virol. 83(16):7931
2. Cao W et al. 2009. J. Exp. Med. 206(7):1603
3. Neil SJ. et al. 2008. Nature 451:425 - Gene ID
- 69550 View all products for this Gene ID
- UniProt
- View information about CD317 on UniProt.org
Other Formats
View All CD317 Reagents Request Custom ConjugationCompare Data Across All Formats
This data display is provided for general comparisons between formats.
Your actual data may vary due to variations in samples, target cells, instruments and their settings, staining conditions, and other factors.
If you need assistance with selecting the best format contact our expert technical support team.
-
Purified anti-mouse CD317 (BST2, PDCA-1)
-
PE anti-mouse CD317 (BST2, PDCA-1)
-
Alexa Fluor® 488 anti-mouse CD317 (BST2, PDCA-1)
-
Alexa Fluor® 647 anti-mouse CD317 (BST2, PDCA-1)
-
APC anti-mouse CD317 (BST2, PDCA-1)
-
Pacific Blue™ anti-mouse CD317 (BST2, PDCA-1)
-
Biotin anti-mouse CD317 (BST2, PDCA-1)
-
FITC anti-mouse CD317 (BST2, PDCA-1)
-
Brilliant Violet 650™ anti-mouse CD317 (BST2, PDCA-1)
-
PerCP/Cyanine5.5 anti-mouse CD317 (BST2, PDCA-1)
-
Brilliant Violet 421™ anti-mouse CD317 (BST2, PDCA-1)
-
Brilliant Violet 605™ anti-mouse CD317 (BST2, PDCA-1)
-
TotalSeq™-A0811 anti-mouse CD317 (BST2, PDCA-1)
-
Ultra-LEAF™ Purified anti-mouse CD317 (BST2, PDCA-1)
-
TotalSeq™-C0811 anti-mouse CD317 (BST2, PDCA-1)
-
Alexa Fluor® 700 anti-mouse CD317 (BST2, PDCA-1)
-
Brilliant Violet 711™ anti-mouse CD317 (BST2, PDCA-1)
-
TotalSeq™-B0811 anti-mouse CD317 (BST2, PDCA-1) Antibody
-
Spark UV™ 387 anti-mouse CD317 (BST2, PDCA-1)
-
PerCP/Fire™ 806 anti-mouse CD317 (BST2, PDCA-1)
-
Spark PLUS UV395™ anti-mouse CD317 (BST2, PDCA-1)