TotalSeq™-A0813 anti-mouse CD9 Antibody

Pricing & Availability
Clone
MZ3 (See other available formats)
Regulatory Status
RUO
Other Names
DRAP-27, MRP-1, p-24
Isotype
Rat IgG2a, κ
Barcode Sequence
TAGCAGTCACTCCTA
Cat # Size Price Quantity Check Availability
124819 10 µg $369.00
Check Availability


Need larger quantities of this item?
Request Bulk Quote
Description

CD9 is a surface glycoprotein of the tetraspannin family. It is expressed on a variety of cells, including nerve, muscle cells and many cells of hematopoietic origin. CD9 is found to participate in forming a large molecular cell complex with other membrane proteins, such as MHC class II, CD19, CD5 and other TM4SF molecules. It is reported that CD9 is a marker of marginal zone B cells, B1 cells and plasma cells. The diverse functions of CD9 may largely depend upon its associated molecules on different cells.

Technical data sheet

Product Details

Verified Reactivity
Mouse
Antibody Type
Monoclonal
Host Species
Rat
Formulation
Phosphate-buffered solution, pH 7.2, containing 0.09% sodium azide and EDTA
Preparation
The antibody was purified by chromatography and conjugated with TotalSeq™-A oligomer under optimal conditions.
Concentration
0.5 mg/ml
Storage & Handling
The antibody solution should be stored undiluted between 2°C and 8°C. Do not freeze.
Application

PG - Quality tested

Recommended Usage

Each lot of this antibody is quality control tested by immunofluorescent staining with flow cytometric analysis and the oligomer sequence is confirmed by sequencing. TotalSeq™-A antibodies are compatible with 10x Genomics Single Cell Gene Expression Solutions.

To maximize performance, it is strongly recommended that the reagent be titrated for each application, and that you centrifuge the antibody dilution before adding to the cells at 14,000xg at 2 - 8°C for 10 minutes. Carefully pipette out the liquid avoiding the bottom of the tube and add to the cell suspension. For Proteogenomics analysis, the suggested starting amount of this reagent for titration is ≤ 1.0 µg per million cells in 100 µL volume. Refer to the corresponding TotalSeq™ protocol for specific staining instructions.


Buyer is solely responsible for determining whether Buyer has all intellectual property rights that are necessary for Buyer's intended uses of the BioLegend TotalSeq™ products. For example, for any technology platform Buyer uses with TotalSeq™, it is Buyer's sole responsibility to determine whether it has all necessary third party intellectual property rights to use that platform and TotalSeq™ with that platform.
Additional Product Notes

TotalSeq™ reagents are designed to profile protein levels at a single cell level following an optimized protocol similar to the CITE-seq workflow. A compatible single cell device (e.g. 10x Genomics Chromium System and Reagents) and sequencer (e.g. Illumina analyzers) are required. Please contact technical support for more information, or visit biolegend.com/totalseq.

The barcode flanking sequences are CCTTGGCACCCGAGAATTCCA (PCR handle), and BAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA*A*A (capture sequence). B represents either C, G, or T, and * indicates a phosphorothioated bond, to prevent nuclease degradation.

View more applications data for this product in our Scientific Poster Library.

Application References

(PubMed link indicates BioLegend citation)
  1. Won WJ, et al. 2002. J. Immunol. 168:5605. (FC, WB)
Product Citations
  1. Al-Rifai R, et al. 2022. Nat Commun. 13:6592. PubMed
RRID
AB_2800600 (BioLegend Cat. No. 124819)

Antigen Details

Structure
24 kd surface glycoprotein belonging to the tetraspanin (TM4SF)family which is characterized by four transmembrane-spanning domains and two extracellular domains.
Distribution

CD9 is expressed in nerve, muscle, keratinocytes, fibroblasts and a variety of hematopoietic cells including monocytes, macrophages, granulocytes , platelets and activated T and B cells.

Interaction
CD9 may participate in forming large molecular complexes with other associated molecules.
Cell Type
B cells, Embryonic Stem Cells, Fibroblasts, Granulocytes, Macrophages, Monocytes, Platelets, T cells
Biology Area
Immunology, Stem Cells
Molecular Family
CD Molecules
Antigen References

1. Boucheix C, et al. 1991. J. Biol. Chem. 266:117
2. Lanza F, et al. 1991. J. Biol. Chem. 266:10638

Gene ID
12527 View all products for this Gene ID
UniProt
View information about CD9 on UniProt.org
Go To Top Version: 1    Revision Date: 01/07/2019

8999 BioLegend Way, San Diego, CA 92121 www.biolegend.com
Toll-Free Phone: 1-877-Bio-Legend (246-5343) Phone: (858) 768-5800 Fax: (877) 455-9587

This data display is provided for general comparisons between formats.
Your actual data may vary due to variations in samples, target cells, instruments and their settings, staining conditions, and other factors.
If you need assistance with selecting the best format contact our expert technical support team.

Login/Register
Forgot your password? Reset Password
Request an Account