TotalSeq™-A0844 anti-human CD45RB Antibody

Pricing & Availability
Clone
MEM-55 (See other available formats)
Regulatory Status
RUO
Workshop
V CD45.08
Other Names
CD45RB
Isotype
Mouse IgG2b, κ
Barcode Sequence
AGATGGGACTCACCA
Cat # Size Price Quantity Check Availability
310209 10 µg $369.00
Check Availability


Need larger quantities of this item?
Request Bulk Quote
Description

CD45RB is a 180-240 kD single chain type I membrane glycoprotein. It is an exon 5 splice variant of the tyrosine phosphatase CD45. The CD45RB isoform is expressed on thymocytes, T cell subsets, B cells, monocytes/macrophages, granulocytes, and dendritic cells. CD45RB enhances both T cell receptor and B cell receptor signaling mediated activation. CD45 and its isoforms non-covalently associate with lymphocyte phosphatase-associated phosphoprotein (LPAP) on T and B lymphocytes. CD45 has been reported to be associated with several other cell surface antigens including CD1, CD2, CD3, and CD4. CD45 has also been reported to bind galectin-1. CD45 isoform expression can change in response to cytokines. The MEM-55 antibody recognizes a silaidase-sensitive epitope of CD45.

Technical data sheet

Product Details

Verified Reactivity
Human
Reported Reactivity
African Green, Baboon, Cynomolgus, Rhesus
Antibody Type
Monoclonal
Host Species
Mouse
Immunogen
Human thymocytes and T lymphocytes
Formulation
Phosphate-buffered solution, pH 7.2, containing 0.09% sodium azide and EDTA
Preparation
The antibody was purified by chromatography and conjugated with TotalSeq™-A oligomer under optimal conditions.
Concentration
0.5 mg/ml
Storage & Handling
The antibody solution should be stored undiluted between 2°C and 8°C. Do not freeze.
Application

PG - Quality tested

Recommended Usage

Each lot of this antibody is quality control tested by immunofluorescent staining with flow cytometric analysis and the oligomer sequence is confirmed by sequencing. TotalSeq™-A antibodies are compatible with 10x Genomics Single Cell Gene Expression Solutions.

To maximize performance, it is strongly recommended that the reagent be titrated for each application, and that you centrifuge the antibody dilution before adding to the cells at 14,000xg at 2 - 8°C for 10 minutes. Carefully pipette out the liquid avoiding the bottom of the tube and add to the cell suspension. For Proteogenomics analysis, the suggested starting amount of this reagent for titration is ≤ 1.0 µg per million cells in 100 µL volume. Refer to the corresponding TotalSeq™ protocol for specific staining instructions.


Buyer is solely responsible for determining whether Buyer has all intellectual property rights that are necessary for Buyer's intended uses of the BioLegend TotalSeq™ products. For example, for any technology platform Buyer uses with TotalSeq™, it is Buyer's sole responsibility to determine whether it has all necessary third party intellectual property rights to use that platform and TotalSeq™ with that platform.
Application Notes

The MEM-55 antibody is specific for a glycosylated-CD45RB epitope that is highly expressed on memory B cells and plasmablasts but not on naïve B cells. Additional reported applications (for the relevant formats) include: immunoprecipitation, Western blotting, and immunohistochemical staining of formalin-fixed paraffin-embedded tissue sections.

Additional Product Notes

TotalSeq™ reagents are designed to profile protein levels at a single cell level following an optimized protocol similar to the CITE-seq workflow. A compatible single cell device (e.g. 10x Genomics Chromium System and Reagents) and sequencer (e.g. Illumina analyzers) are required. Please contact technical support for more information, or visit biolegend.com/totalseq.

The barcode flanking sequences are CCTTGGCACCCGAGAATTCCA (PCR handle), and BAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA*A*A (capture sequence). B represents either C, G, or T, and * indicates a phosphorothioated bond, to prevent nuclease degradation.

View more applications data for this product in our Scientific Poster Library.

Application References

(PubMed link indicates BioLegend citation)
  1. Horejsi V, et al. 1988. Folia Biol. 34:23.
  2. Bazil V, et al. 1989. Immunogenetics 29:202.
  3. Knapp W, et al. 1989. Leucocyte Typing IV. Oxford University Press. New York.
  4. Schlossman S, et al. Eds. 1995. Leucocyte Typing V. Oxford University Press. New York.
  5. Koethe S, et al. 2011. J. Leukoc. Biol. 90:5.
Product Citations
  1. Guilliams M, et al. 2022. Cell. 185:379. PubMed
  2. Hao Y, et al. 2021. Cell. 184:3573. PubMed
RRID
AB_2810471 (BioLegend Cat. No. 310209)

Antigen Details

Structure
Tyrosine phosphatases, type I transmembrane, 180-240 kD (exon 5 splicing of CD45 gene)
Distribution

Thymocytes, T cell subset, B cells, monocytes/macrophages, granulocytes, dendritic cells

Function
Enhances TCR and BCR signaling
Ligand/Receptor
Galectin-1, CD2, CD3, CD4
Cell Type
B cells, Dendritic cells, Granulocytes, Macrophages, Monocytes, T cells, Thymocytes, Tregs
Biology Area
Cell Biology, Immunology, Inhibitory Molecules, Neuroscience, Neuroscience Cell Markers
Molecular Family
CD Molecules
Antigen References

1. Thomas M. 1989. Annu. Rev. Immunol. 7:339.
2. Trowbridge I, et al. 1994. Annu. Rev. Immunol.12:85.

Gene ID
5788 View all products for this Gene ID
UniProt
View information about CD45RB on UniProt.org
Go To Top Version: 1    Revision Date: 06/13/2019

8999 BioLegend Way, San Diego, CA 92121 www.biolegend.com
Toll-Free Phone: 1-877-Bio-Legend (246-5343) Phone: (858) 768-5800 Fax: (877) 455-9587

This data display is provided for general comparisons between formats.
Your actual data may vary due to variations in samples, target cells, instruments and their settings, staining conditions, and other factors.
If you need assistance with selecting the best format contact our expert technical support team.

Login/Register
Forgot your password? Reset Password
Request an Account