TotalSeq™-A0849 anti-mouse CD80 Antibody

Pricing & Availability
Clone
16-10A1 (See other available formats)
Regulatory Status
RUO
Other Names
B7-1, B7, Ly-53
Isotype
Armenian Hamster IgG
Barcode Sequence
GACCCGGTGTCATTT
Cat # Size Price Quantity Check Availability
104745 10 µg $369.00
Check Availability


Need larger quantities of this item?
Request Bulk Quote
Description

CD80 is a 60 kD highly glycosylated protein. It is a member of the Ig superfamily and is also known as B7-1, B7, and Ly-53. CD80 is constitutively expressed on dendritic cells and monocytes/macrophages, and inducibly expressed on activated B and T cells. The ligation of CD28 on T cells with CD80 and CD86 (B7-2) on antigen presenting cells (such as dendritic cells, macrophages, and B cells) elicits co-stimulation of T cells resulting in enhanced cell activation, proliferation, and cytokine production. CD80 appears to be expressed later in the immune response than CD86. CD80 can also bind to CD152, also known as CTLA-4, to deliver an inhibitory signal to T cells.

Technical data sheet

Product Details

Verified Reactivity
Mouse
Reported Reactivity
Dog
Antibody Type
Monoclonal
Host Species
Armenian Hamster
Immunogen
CHO cell line transfected with mouse B7 (CD80)
Formulation
Phosphate-buffered solution, pH 7.2, containing 0.09% sodium azide and EDTA
Preparation
The antibody was purified by chromatography and conjugated with TotalSeq™-A oligomer under optimal conditions.
Concentration
0.5 mg/ml
Storage & Handling
The antibody solution should be stored undiluted between 2°C and 8°C. Do not freeze.
Application

PG - Quality tested

Recommended Usage

Each lot of this antibody is quality control tested by immunofluorescent staining with flow cytometric analysis and the oligomer sequence is confirmed by sequencing. TotalSeq™-A antibodies are compatible with 10x Genomics Single Cell Gene Expression Solutions.

To maximize performance, it is strongly recommended that the reagent be titrated for each application, and that you centrifuge the antibody dilution before adding to the cells at 14,000xg at 2 - 8°C for 10 minutes. Carefully pipette out the liquid avoiding the bottom of the tube and add to the cell suspension. For Proteogenomics analysis, the suggested starting amount of this reagent for titration is ≤ 1.0 µg per million cells in 100 µL volume. Refer to the corresponding TotalSeq™ protocol for specific staining instructions.


Buyer is solely responsible for determining whether Buyer has all intellectual property rights that are necessary for Buyer's intended uses of the BioLegend TotalSeq™ products. For example, for any technology platform Buyer uses with TotalSeq™, it is Buyer's sole responsibility to determine whether it has all necessary third party intellectual property rights to use that platform and TotalSeq™ with that platform.
Application Notes

Additional reported applications (for the relevant formats) include: immunoprecipitation2, in vitro and in vivo blocking of CTLA-4 Ig to CD80 by blocking costimulation of T cells by activated B cells2-4, and immunohistochemical staining of acetone-fixed frozen sections1,4. The Ultra-LEAF™ purified antibody (Endotoxin < 0.01 EU/µg, Azide-Free, 0.2 µm filtered) is recommended for functional assays (Cat. Nos. 104747-104752).

Additional Product Notes

TotalSeq™ reagents are designed to profile protein levels at a single cell level following an optimized protocol similar to the CITE-seq workflow. A compatible single cell device (e.g. 10x Genomics Chromium System and Reagents) and sequencer (e.g. Illumina analyzers) are required. Please contact technical support for more information, or visit biolegend.com/totalseq.

The barcode flanking sequences are CCTTGGCACCCGAGAATTCCA (PCR handle), and BAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA*A*A (capture sequence). B represents either C, G, or T, and * indicates a phosphorothioated bond, to prevent nuclease degradation.

View more applications data for this product in our Scientific Poster Library.

Application References

(PubMed link indicates BioLegend citation)
  1. Harlan DM, et al. 1994. P. Natl. Acad. Sci. USA 91:3137. (IHC)
  2. Razi-Wolf Z, et al. 1992. P. Natl. Acad. Sci. USA 89:4210. (Block, IP)
  3. Hathcock KS, et al. 1994. J. Exp. Med. 180:631. (Block)
  4. Herold KC, et al. 1997. J. Immunol. 158:984. (Block, IHC)
  5. Ma XT, et al. 2006. Cancer Res. 66:1169.
  6. Andoniou CE, et al. 2005. Nature Immunology 6:1011. (FC)
  7. Lawson BR, et al. 2007. J. Immunol. 178:5366.
  8. Turnquist HR, et al. 2007. J. Immunol. 178:7018.
  9. Misra RS, et al. 2010. J. Exp Med. 207:1775. PubMed
  10. del Rio ML, et al. 2011. Transpl. Int. 24:501. (FC) PubMed
  11. Philipsen L, et al. 2013. Mol Cell Proteomics. 12:2551. PubMed
Product Citations
  1. Al-Rifai R, et al. 2022. Nat Commun. 13:6592. PubMed
  2. Guilliams M, et al. 2022. Cell. 185:379. PubMed
RRID
AB_2813935 (BioLegend Cat. No. 104745)

Antigen Details

Structure
Ig superfamily, 60 kD
Distribution

Macrophages, activated B cells and T cells, dendritic cells

Function
T cell costimulation
Ligand/Receptor
CD28 (stimulatory), CD152(CTLA4) (inhibitory)
Cell Type
B cells, Dendritic cells, Macrophages, T cells, Tregs
Biology Area
Cell Biology, Costimulatory Molecules, Immunology, Neuroscience, Neuroscience Cell Markers
Molecular Family
CD Molecules, Immune Checkpoint Receptors
Antigen References

1. Barclay AN, et al. 1997. The Leukocyte Antigen FactsBook Academic Press.
2. Linsley PS, et al. 1991. J. Exp. Med. 174:561.
3. Salomon B, et al. 2001. Annu. Rev. Immunol. 19:225.

Gene ID
12519 View all products for this Gene ID
UniProt
View information about CD80 on UniProt.org
Go To Top Version: 1    Revision Date: 07/29/2019

8999 BioLegend Way, San Diego, CA 92121 www.biolegend.com
Toll-Free Phone: 1-877-Bio-Legend (246-5343) Phone: (858) 768-5800 Fax: (877) 455-9587

This data display is provided for general comparisons between formats.
Your actual data may vary due to variations in samples, target cells, instruments and their settings, staining conditions, and other factors.
If you need assistance with selecting the best format contact our expert technical support team.

Login/Register
Forgot your password? Reset Password
Request an Account