TotalSeq™-A0903 anti-mouse CD40 Antibody

Pricing & Availability
Clone
3/23 (See other available formats)
Regulatory Status
RUO
Other Names
Bp50, TNFRSF5
Isotype
Rat IgG2a, κ
Barcode Sequence
ATTTGTATGCTGGAG
Compare all formats
Cat # Size Price Quantity Check Availability
124633 10 µg $369.00
Check Availability


Need larger quantities of this item?
Request Bulk Quote
Description

CD40 is a 48 kD type I transmembrane glycoprotein also known as Bp50. It is a member of the tumor necrosis factor receptor (TNFR) superfamily and is expressed on B cells, basal epithelial cells, macrophages, follicular dendritic cells, endothelial cells, and a subset of CD34+ hematopoietic progenitors. CD40 regulates B cell development/maturation, Ig isotype switching and, in combination with other signals such as IL-4, protects B cells from surface Ig-induced apoptosis and promotes proliferation. Interaction of CD40 with its ligand CD154 (gp39), which is expressed on activated T cells, is important in costimulation and immune regulation.

Technical data sheet

Product Details

Verified Reactivity
Mouse
Antibody Type
Monoclonal
Host Species
Rat
Immunogen
Recombinant mouse CD40 protein
Formulation
Phosphate-buffered solution, pH 7.2, containing 0.09% sodium azide and EDTA
Preparation
The antibody was purified by chromatography and conjugated with TotalSeq™-A oligomer under optimal conditions.
Concentration
0.5 mg/ml
Storage & Handling
The antibody solution should be stored undiluted between 2°C and 8°C. Do not freeze.
Application

PG - Quality tested
Recommended Usage

Each lot of this antibody is quality control tested by immunofluorescent staining with flow cytometric analysis and the oligomer sequence is confirmed by sequencing. TotalSeq™-A antibodies are compatible with 10x Genomics Single Cell Gene Expression Solutions.

To maximize performance, it is strongly recommended that the reagent be titrated for each application, and that you centrifuge the antibody dilution before adding to the cells at 14,000xg at 2 - 8°C for 10 minutes. Carefully pipette out the liquid avoiding the bottom of the tube and add to the cell suspension. For Proteogenomics analysis, the suggested starting amount of this reagent for titration is ≤ 1.0 µg per million cells in 100 µL volume. Refer to the corresponding TotalSeq™ protocol for specific staining instructions.


Buyer is solely responsible for determining whether Buyer has all intellectual property rights that are necessary for Buyer's intended uses of the BioLegend TotalSeq™ products. For example, for any technology platform Buyer uses with TotalSeq™, it is Buyer's sole responsibility to determine whether it has all necessary third party intellectual property rights to use that platform and TotalSeq™ with that platform.
Application Notes

For highly sensitive assays, we recommend Ultra-LEAF™ purified antibody (Cat. No. 124627 &124628) with a low endotoxin limit (Endotoxin < 0.01 EU/µg).

Additional Product Notes

TotalSeq™ reagents are designed to profile protein levels at a single cell level following an optimized protocol similar to the CITE-seq workflow. A compatible single cell device (e.g. 10x Genomics Chromium System and Reagents) and sequencer (e.g. Illumina analyzers) are required. Please contact technical support for more information, or visit biolegend.com/totalseq.

The barcode flanking sequences are CCTTGGCACCCGAGAATTCCA (PCR handle), and BAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA*A*A (capture sequence). B represents either C, G, or T, and * indicates a phosphorothioated bond, to prevent nuclease degradation.

View more applications data for this product in our Scientific Poster Library.

Application References

(PubMed link indicates BioLegend citation)
  1. Hasbold J, et al. 1994. Eur. J. Immunol. 24:1835.
  2. Bourgeois C, et al. 2002. Science 297:2060.
RRID
AB_2813997 (BioLegend Cat. No. 124633)

Antigen Details

Structure
48 kD type I transmembrane glycoprotein, a member of the tumor necrosis factor receptor (TNFR) superfamily.
Distribution

Expressed on B lymphocytes and other antigen-presenting cells, such as macrophages, follicular dendritic cells, etc.

Function
Regulates B cell growth and differentiation and Ig isotype switching. Interaction of CD40 with its ligand, CD154, on activated T cells is important for immune response.
Ligand/Receptor
CD154 on T cells
Cell Type
Antigen-presenting cells, B cells, Dendritic cells, Macrophages
Biology Area
Cell Biology, Costimulatory Molecules, Immunology, Neuroscience, Neuroscience Cell Markers
Molecular Family
CD Molecules
Antigen References

1. Grewal IS, et al. 1998. Annu Rev Immunol 16:111.

Gene ID
21939 View all products for this Gene ID
UniProt
View information about CD40 on UniProt.org
Go To Top Version: 1    Revision Date: 08/23/2019

8999 BioLegend Way, San Diego, CA 92121 www.biolegend.com
Toll-Free Phone: 1-877-Bio-Legend (246-5343) Phone: (858) 768-5800 Fax: (877) 455-9587

This data display is provided for general comparisons between formats.
Your actual data may vary due to variations in samples, target cells, instruments and their settings, staining conditions, and other factors.
If you need assistance with selecting the best format contact our expert technical support team.

Login/Register
Forgot your password? Reset Password
Request an Account