TotalSeq™-A0936 anti-human CD317 (BST2, Tetherin) Antibody

Pricing & Availability
Clone
RS38E (See other available formats)
Regulatory Status
RUO
Workshop
VIII
Other Names
BST2, Tetherin, HM1.24, Bone marrow stromal antigen 2
Isotype
Mouse IgG1, κ
Barcode Sequence
AAGAGCCGTTGTGAA
Compare all formats
Cat # Size Price Quantity Check Availability
348417 10 µg $358.00
Check Availability


Need larger quantities of this item?
Request Bulk Quote
Description

CD317, also known as BST2, Tetherin, and HM1.24, is a type II transmembrane GPI-protein with a molecular weight of about 29-33 kD. It is an interferon-induced protein expressed on dendritic cells, plasma cells, B lymphoblast cells, monocytes, granulocytes, T cells, NK cells, stromal cells, and some non-hematopoietic cells. BST2 inhibits cytokine production through interaction with ILT7 (CD85g). It is also involved in the regulation of B cell growth. More importantly, BST2 has been found to restrict the release of a number of viruses from infected cells, including all tested retroviruses (such as HIV-1) and some arenaviruses and filoviruses. In HIV-1 studies, it has been reported that BST2 retains the nascent virons on the surface of infected cells by incorporation of the protein into HIV-1 particles. HIV-1 Vpu is able to induce BST2 degradation.

Technical data sheet

Product Details

Verified Reactivity
Human, Cynomolgus, Rhesus
Reported Reactivity
African Green, Baboon, Pigtailed Macaque
Antibody Type
Monoclonal
Host Species
Mouse
Formulation
Phosphate-buffered solution, pH 7.2, containing 0.09% sodium azide and EDTA
Preparation
The antibody was purified by chromatography and conjugated with TotalSeq™-A oligomer under optimal conditions.
Concentration
0.5 mg/mL
Storage & Handling
The antibody solution should be stored undiluted between 2°C and 8°C. Do not freeze.
Application

PG - Quality tested
Recommended Usage

Each lot of this antibody is quality control tested by immunofluorescent staining with flow cytometric analysis and the oligomer sequence is confirmed by sequencing. TotalSeq™-A antibodies are compatible with 10x Genomics Single Cell Gene Expression Solutions.

To maximize performance, it is strongly recommended that the reagent be titrated for each application, and that you centrifuge the antibody dilution before adding to the cells at 14,000xg at 2 - 8°C for 10 minutes. Carefully pipette out the liquid avoiding the bottom of the tube and add to the cell suspension. For Proteogenomics analysis, the suggested starting amount of this reagent for titration is ≤ 1.0 µg per million cells in 100 µL volume. Refer to the corresponding TotalSeq™ protocol for specific staining instructions.


Buyer is solely responsible for determining whether Buyer has all intellectual property rights that are necessary for Buyer's intended uses of the BioLegend TotalSeq™ products. For example, for any technology platform Buyer uses with TotalSeq™, it is Buyer's sole responsibility to determine whether it has all necessary third party intellectual property rights to use that platform and TotalSeq™ with that platform.
Additional Product Notes

TotalSeq™ reagents are designed to profile protein levels at a single cell level following an optimized protocol similar to the CITE-seq workflow. A compatible single cell device (e.g. 10x Genomics Chromium System and Reagents) and sequencer (e.g. Illumina analyzers) are required. Please contact technical support for more information, or visit biolegend.com/totalseq.

The barcode flanking sequences are CCTTGGCACCCGAGAATTCCA (PCR handle), and BAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA*A*A (capture sequence). B represents either C, G, or T, and * indicates a phosphorothioated bond, to prevent nuclease degradation.

View more applications data for this product in our Scientific Poster Library.

Application References

(PubMed link indicates BioLegend citation)
  1. Ishikawa J, et al. 1995. Genomics 26:527.
  2. Miyagi E, et al. 2011. J. Virol. 85:11981. PubMed
  3. Yokoyama T, et al. 2013. Int. J. Cancer. 132: 472. (FC) PubMed
RRID
AB_2924548 (BioLegend Cat. No. 348417)

Antigen Details

Structure
Type II transmembrane, GPI-anchored protein, 29-33 kD
Distribution

Dendritic cells, plasma cells, B lymphoblast cells, monocytes, granulocytes, T cells, NK cells, stromal cells

Function
Regulate B cell growth, inhibit cytokine production, retain progeny virons on the surface of infected cells
Ligand/Receptor
ILT7 (CD85g)
Cell Type
B cells, Dendritic cells, Granulocytes, Monocytes, NK cells, Plasma cells, T cells
Biology Area
Costimulatory Molecules, Immunology, Innate Immunity
Molecular Family
Adhesion Molecules, CD Molecules
Antigen References

1. Sugamata OT, et al. 1999. Biochem. Bioph. Res. Co. 258:583.
2. Neil SJ, et al. 2008. Nature 451:425.
3. Fitzpatrick K, et al. 2010. PLoS Pathog. 6:e1000701.
4. Azuma KS, et al. 2008. Cancer Sci. 99:2461.
5. Cao W, et al. 2009. J. Exp. Med. 206:1603.
6. Zola H, et al. 2007. Leukocyte and Stromal Cell Molecules:The CD Markers.

Gene ID
684 View all products for this Gene ID
UniProt
View information about CD317 on UniProt.org
Go To Top Version: 1    Revision Date: 09/19/2022

8999 BioLegend Way, San Diego, CA 92121 www.biolegend.com
Toll-Free Phone: 1-877-Bio-Legend (246-5343) Phone: (858) 768-5800 Fax: (877) 455-9587

This data display is provided for general comparisons between formats.
Your actual data may vary due to variations in samples, target cells, instruments and their settings, staining conditions, and other factors.
If you need assistance with selecting the best format contact our expert technical support team.

Login/Register
Forgot your password? Reset Password
Request an Account