TotalSeq™-A0949 anti-mouse CD226 (DNAM-1) Antibody

Pricing & Availability
Clone
TX42.1 (See other available formats)
Regulatory Status
RUO
Other Names
DNAM-1, PTA1 (Platelet and T cell activation antigen 1), TLISA1, LFA-1 associated molecule PTA-1
Isotype
Rat IgG2a, κ
Barcode Sequence
CGGTATCCGTCAGTT
Compare all formats
Cat # Size Price Quantity Check Availability
133633 10 µg $369.00
Check Availability


Need larger quantities of this item?
Request Bulk Quote
Description

Mouse CD226 (DNAM-1) is a 65 kd glycoprotein of a member of Ig super-family adhesion molecule containing 2 immunoglobulin-like domains. It is associated with leukocyte function associated antigen-1 (LFA-1) involving in TCR-mediated signal transduction for T cell proliferation and differentiation. CD226 is also involved in NK cell and T cell mediated cytotoxicity against certain tumors. CD226 (DNAM-1) is constitutively expressed on naïve CD8+ and CD4+ T cells, macrophages, and NK cells. It was reported that CD226 expression is up-regulated on Th1 cells, but down-regulated on Th2 and Th0 cells. CD155 and CD112 are the ligands for CD226.

Technical data sheet

Product Details

Verified Reactivity
Mouse
Antibody Type
Monoclonal
Host Species
Rat
Immunogen
Mouse DNAM-1 transfected cells
Formulation
Phosphate-buffered solution, pH 7.2, containing 0.09% sodium azide and EDTA
Preparation
The antibody was purified by chromatography and conjugated with TotalSeq™-A oligomer under optimal conditions.
Concentration
0.5 mg/mL
Storage & Handling
The antibody solution should be stored undiluted between 2°C and 8°C. Do not freeze.
Application

PG - Quality tested
Recommended Usage

Each lot of this antibody is quality control tested by immunofluorescent staining with flow cytometric analysis and the oligomer sequence is confirmed by sequencing. TotalSeq™-A antibodies are compatible with 10x Genomics Single Cell Gene Expression Solutions.

To maximize performance, it is strongly recommended that the reagent be titrated for each application, and that you centrifuge the antibody dilution before adding to the cells at 14,000xg at 2 - 8°C for 10 minutes. Carefully pipette out the liquid avoiding the bottom of the tube and add to the cell suspension. For Proteogenomics analysis, the suggested starting amount of this reagent for titration is ≤ 1.0 µg per million cells in 100 µL volume. Refer to the corresponding TotalSeq™ protocol for specific staining instructions.


Buyer is solely responsible for determining whether Buyer has all intellectual property rights that are necessary for Buyer's intended uses of the BioLegend TotalSeq™ products. For example, for any technology platform Buyer uses with TotalSeq™, it is Buyer's sole responsibility to determine whether it has all necessary third party intellectual property rights to use that platform and TotalSeq™ with that platform.
Additional Product Notes

TotalSeq™ reagents are designed to profile protein levels at a single cell level following an optimized protocol similar to the CITE-seq workflow. A compatible single cell device (e.g. 10x Genomics Chromium System and Reagents) and sequencer (e.g. Illumina analyzers) are required. Please contact technical support for more information, or visit biolegend.com/totalseq.

The barcode flanking sequences are CCTTGGCACCCGAGAATTCCA (PCR handle), and BAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA*A*A (capture sequence). B represents either C, G, or T, and * indicates a phosphorothioated bond, to prevent nuclease degradation.

View more applications data for this product in our Scientific Poster Library.

Application References

(PubMed link indicates BioLegend citation)
  1. Dardalhon V, et al. 2005. J. Immunol. 175:1558
  2. Shirakawa J, et al. 2006. International Immunology 18(6):951-957
RRID
AB_2941419 (BioLegend Cat. No. 133633)

Antigen Details

Structure
65 kd glycoprotein of a member of Ig super-family containing 2 immunoglobulin-like domains.
Distribution

Expressed on majority of CD8+ and CD4+ T cells, NK cells, monocytes/macrophages and a subset of B cells. Reported to up-regulated on Th1 cells, but down-regulated in Th2 cells.

Function
Mediate cellular adhesion, involved in LFA-1 co-stimulatory signal for T cell differentiation and proliferation.
Ligand/Receptor
CD112 and CD155
Cell Type
B cells, Macrophages, Monocytes, NK cells, T cells, Th1
Biology Area
Immunology
Molecular Family
Adhesion Molecules, CD Molecules
Antigen References

1 Tahara Hanaoka S, et al. 2006. Blood. 107:1491
2 Shibuya K et al. 2003. J. Exp. Med. 198:1829.

Gene ID
225825 View all products for this Gene ID
UniProt
View information about CD226 on UniProt.org
Go To Top Version: 1    Revision Date: 05/02/2023

8999 BioLegend Way, San Diego, CA 92121 www.biolegend.com
Toll-Free Phone: 1-877-Bio-Legend (246-5343) Phone: (858) 768-5800 Fax: (877) 455-9587

This data display is provided for general comparisons between formats.
Your actual data may vary due to variations in samples, target cells, instruments and their settings, staining conditions, and other factors.
If you need assistance with selecting the best format contact our expert technical support team.

Login/Register
Forgot your password? Reset Password
Request an Account