- Clone
- 18d3 (See other available formats)
- Regulatory Status
- RUO
- Other Names
- Kp43
- Isotype
- Rat IgG2a, κ
- Barcode Sequence
- CACAGTTGTCCGTGT
Cat # | Size | Price | Quantity Check Availability | ||
---|---|---|---|---|---|
105515 | 10 µg | $369.00 |
CD94 is a 43/39 kD C-type lectin, also known as Kp43. It is present on all NK cells, NKT cells, and a subset of CD8-positive T lymphocytes in most mouse strains. CD94 is a type-II transmembrane protein with an extracellular lectin-like domain and a short cytoplasmic tail. CD94 is expressed as a disulphide-linked heterodimer with a NKG2 subunit believed to mediate signal transduction. When associated with NKG2A, the complex triggers inhibition; when associated with NKG2C, the complex triggers stimulation. The receptor complex of CD94 and NKG2 receptors bind to the ligand, Qa-1, and are thought to play a role in maintaining self-tolerance in developing NK cells.
Product Details
- Verified Reactivity
- Mouse
- Antibody Type
- Monoclonal
- Host Species
- Rat
- Immunogen
- CHO cells expressing the C57BL/6 alleles of CD94 and NKG2A
- Formulation
- Phosphate-buffered solution, pH 7.2, containing 0.09% sodium azide and EDTA
- Preparation
- The antibody was purified by chromatography and conjugated with TotalSeq™-A oligomer under optimal conditions.
- Concentration
- 0.5 mg/mL
- Storage & Handling
- The antibody solution should be stored undiluted between 2°C and 8°C. Do not freeze.
- Application
-
PG - Quality tested
- Recommended Usage
-
Each lot of this antibody is quality control tested by immunofluorescent staining with flow cytometric analysis and the oligomer sequence is confirmed by sequencing. TotalSeq™-A antibodies are compatible with 10x Genomics Single Cell Gene Expression Solutions.
To maximize performance, it is strongly recommended that the reagent be titrated for each application, and that you centrifuge the antibody dilution before adding to the cells at 14,000xg at 2 - 8°C for 10 minutes. Carefully pipette out the liquid avoiding the bottom of the tube and add to the cell suspension. For Proteogenomics analysis, the suggested starting amount of this reagent for titration is ≤ 1.0 µg per million cells in 100 µL volume. Refer to the corresponding TotalSeq™ protocol for specific staining instructions.
Buyer is solely responsible for determining whether Buyer has all intellectual property rights that are necessary for Buyer's intended uses of the BioLegend TotalSeq™ products. For example, for any technology platform Buyer uses with TotalSeq™, it is Buyer's sole responsibility to determine whether it has all necessary third party intellectual property rights to use that platform and TotalSeq™ with that platform. - Additional Product Notes
-
TotalSeq™ reagents are designed to profile protein levels at a single cell level following an optimized protocol similar to the CITE-seq workflow. A compatible single cell device (e.g. 10x Genomics Chromium System and Reagents) and sequencer (e.g. Illumina analyzers) are required. Please contact technical support for more information, or visit biolegend.com/totalseq.
The barcode flanking sequences are CCTTGGCACCCGAGAATTCCA (PCR handle), and BAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA*A*A (capture sequence). B represents either C, G, or T, and * indicates a phosphorothioated bond, to prevent nuclease degradation.
View more applications data for this product in our Scientific Poster Library. -
Application References
(PubMed link indicates BioLegend citation) -
- Vance RE, et al. 1999. J. Exp. Med. 190:1801.
- Tang X, et al. 2006. J. Immunol. 177:7645. PubMed
- RRID
-
AB_2819808 (BioLegend Cat. No. 105515)
Antigen Details
- Structure
- C-type lectin; 43/39 kD
- Distribution
-
NK cells, NK-T cells, CD8+ T subset
- Function
- Inhibits NK cell function
- Ligand/Receptor
- CD94/NKG2
- Cell Type
- NK cells, NKT cells, T cells
- Biology Area
- Immunology, Innate Immunity
- Molecular Family
- CD Molecules
- Antigen References
-
- Barclay A, et al. 1997. The Leukocyte Antigen FactsBook Academic Press.
- Lopez-Botet M, et al. 1997. Immunol. Rev. 155:165.
- Moretta A, et al. 1997. Immunol. Rev. 155:105.
- Phillips JH, et al. 1996. Immunity 5:163.
- Gene ID
- 16643 View all products for this Gene ID
- UniProt
- View information about CD94 on UniProt.org
Other Formats
View All CD94 Reagents Request Custom ConjugationDescription | Clone | Applications |
---|---|---|
FITC anti-mouse CD94 | 18d3 | FC |
PE anti-mouse CD94 | 18d3 | FC |
PE/Cyanine7 anti-mouse CD94 | 18d3 | FC |
APC anti-mouse CD94 | 18d3 | FC |
PerCP/Cyanine5.5 anti-mouse CD94 | 18d3 | FC |
TotalSeq™-A1009 anti-mouse CD94 | 18d3 | PG |
TotalSeq™-C1009 anti-mouse CD94 | 18d3 | PG |
Compare Data Across All Formats
This data display is provided for general comparisons between formats.
Your actual data may vary due to variations in samples, target cells, instruments and their settings, staining conditions, and other factors.
If you need assistance with selecting the best format contact our expert technical support team.