TotalSeq™-A1052 anti-human CD224 Antibody

Pricing & Availability
Clone
KF29 (See other available formats)
Regulatory Status
RUO
Other Names
γ-Glutamyl transferase 1 (GGT1), γ-Glutamyl transpeptidase 1 (GGTP), GGT, GTG
Isotype
Mouse IgG1, κ
Barcode Sequence
CTGATGAGATGTCAG
Cat # Size Price Quantity Check Availability
394311 10 µg $369.00
Check Availability


Need larger quantities of this item?
Request Bulk Quote
Description

CD224, also known as γ-Glutamyl transferase 1 (GGT1), is a  type I gamma-glutamyltransferase, and a member of the threonine peptidase family. CD224 consistes of a 380 amino acid heavy chain and a 189 amino acid light chain, which are translated from a single mRNA. It protects cells from oxidative stress by participating in γ-glutamyl cycle. CD224 is expressed on subset of T cells, B cells, stem cell precursor, endothelial cells and epithelial cells. It expresses on kidney, duodenuma and small intestine.

Technical data sheet

Product Details

Verified Reactivity
Human
Antibody Type
Monoclonal
Host Species
Mouse
Formulation
Phosphate-buffered solution, pH 7.2, containing 0.09% sodium azide and EDTA
Preparation
The antibody was purified by chromatography and conjugated with TotalSeq™-A oligomer under optimal conditions.
Concentration
0.5 mg/mL
Storage & Handling
The antibody solution should be stored undiluted between 2°C and 8°C. Do not freeze.
Application

PG - Quality tested

Recommended Usage

Each lot of this antibody is quality control tested by immunofluorescent staining with flow cytometric analysis and the oligomer sequence is confirmed by sequencing. TotalSeq™-A antibodies are compatible with 10x Genomics Single Cell Gene Expression Solutions.

To maximize performance, it is strongly recommended that the reagent be titrated for each application, and that you centrifuge the antibody dilution before adding to the cells at 14,000xg at 2 - 8°C for 10 minutes. Carefully pipette out the liquid avoiding the bottom of the tube and add to the cell suspension. For Proteogenomics analysis, the suggested starting amount of this reagent for titration is ≤ 1.0 µg per million cells in 100 µL volume. Refer to the corresponding TotalSeq™ protocol for specific staining instructions.


Buyer is solely responsible for determining whether Buyer has all intellectual property rights that are necessary for Buyer's intended uses of the BioLegend TotalSeq™ products. For example, for any technology platform Buyer uses with TotalSeq™, it is Buyer's sole responsibility to determine whether it has all necessary third party intellectual property rights to use that platform and TotalSeq™ with that platform.
Additional Product Notes

TotalSeq™ reagents are designed to profile protein levels at a single cell level following an optimized protocol similar to the CITE-seq workflow. A compatible single cell device (e.g. 10x Genomics Chromium System and Reagents) and sequencer (e.g. Illumina analyzers) are required. Please contact technical support for more information, or visit biolegend.com/totalseq.

The barcode flanking sequences are CCTTGGCACCCGAGAATTCCA (PCR handle), and BAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA*A*A (capture sequence). B represents either C, G, or T, and * indicates a phosphorothioated bond, to prevent nuclease degradation.

View more applications data for this product in our Scientific Poster Library.

RRID
AB_2892461 (BioLegend Cat. No. 394311)

Antigen Details

Structure
Type I gamma-glutamyltransferase
Distribution

Subset of T cells, B cells, stem cell precursor, endothelial cells and epithelial cells

Function
Protects cells from oxidative stress by participating in γ-glutamyl cycle
Ligand/Receptor
Glutathione, GSH, Leukotriene C4, GSNO
Cell Type
B cells, Endothelial cells, Epithelial cells, Hematopoietic stem and progenitors, T cells
Biology Area
Immunology
Molecular Family
CD Molecules
Antigen References
  1. Mizushima T, et al. 2016. BMC Cancer. 16:411.
  2. Wang Q, et al. 2017. Oncotarget. 8:36171–36184.
  3. Jiang Y, et al. 2016. Mol Med Rep. 13:3813-20.
  4. Karp DR, et al. 1999. Int Immunol. 11:1791-800.
Gene ID
2678 View all products for this Gene ID
UniProt
View information about CD224 on UniProt.org
Go To Top Version: 1    Revision Date: 04/05/2021

8999 BioLegend Way, San Diego, CA 92121 www.biolegend.com
Toll-Free Phone: 1-877-Bio-Legend (246-5343) Phone: (858) 768-5800 Fax: (877) 455-9587

This data display is provided for general comparisons between formats.
Your actual data may vary due to variations in samples, target cells, instruments and their settings, staining conditions, and other factors.
If you need assistance with selecting the best format contact our expert technical support team.

Login/Register
Forgot your password? Reset Password
Request an Account