- Clone
- 1B3.3 (See other available formats)
- Regulatory Status
- RUO
- Other Names
- Tib, TCRB, TCRbeta
- Isotype
- Armenian Hamster IgG
- Barcode Sequence
- CCTTTCCGTCGATCA
| Cat # | Size | Price | Quantity Check Availability | ||
|---|---|---|---|---|---|
| 156307 | 10 µg | $369.00 | |||
The TCR Vβ8 family consists of three members, namely Vβ8.1, 8.2 and 8.3. 1B3.3 reacts with Vβ8.3 only, but not Vβ8.1 or Vβ8.2. Most mouse strains have about 20% Vβ8+ T cells in the periphery. However, C57BR, C57L, SJL, SWR (Tcra haplotype) and RIII strains (Tcrc haplotype) do not express Vβ8 due to a gene deletion at the Vβ8 loci. Exogenous superantigen, such as staphylococcal enterotoxin B, stimulates lymphocytes bearing Vβ8 and selectively eliminate those T cells in vivo.
Product Details
- Verified Reactivity
- Mouse
- Antibody Type
- Monoclonal
- Host Species
- Armenian Hamster
- Immunogen
- 3.L2 T Cell Clone Expressing the vβ8.3 TCR
- Formulation
- Phosphate-buffered solution, pH 7.2, containing 0.09% sodium azide and EDTA
- Preparation
- The antibody was purified by chromatography and conjugated with TotalSeq™-A oligomer under optimal conditions.
- Concentration
- 0.5 mg/mL
- Storage & Handling
- The antibody solution should be stored undiluted between 2°C and 8°C. Do not freeze.
- Application
-
PG - Quality tested
- Recommended Usage
-
Each lot of this antibody is quality control tested by immunofluorescent staining with flow cytometric analysis and the oligomer sequence is confirmed by sequencing. TotalSeq™-A antibodies are compatible with 10x Genomics Single Cell Gene Expression Solutions.
To maximize performance, it is strongly recommended that the reagent be titrated for each application, and that you centrifuge the antibody dilution before adding to the cells at 14,000xg at 2 - 8°C for 10 minutes. Carefully pipette out the liquid avoiding the bottom of the tube and add to the cell suspension. For Proteogenomics analysis, the suggested starting amount of this reagent for titration is ≤ 1.0 µg per million cells in 100 µL volume. Refer to the corresponding TotalSeq™ protocol for specific staining instructions.
Buyer is solely responsible for determining whether Buyer has all intellectual property rights that are necessary for Buyer's intended uses of the BioLegend TotalSeq™ products. For example, for any technology platform Buyer uses with TotalSeq™, it is Buyer's sole responsibility to determine whether it has all necessary third party intellectual property rights to use that platform and TotalSeq™ with that platform. - Application Notes
-
Clone 1B3.3 recognizes TCR vß8.3 from both C57BL/6 and BALB/c strains.
- Additional Product Notes
-
TotalSeq™ reagents are designed to profile protein levels at a single cell level following an optimized protocol similar to the CITE-seq workflow. A compatible single cell device (e.g. 10x Genomics Chromium System and Reagents) and sequencer (e.g. Illumina analyzers) are required. Please contact technical support for more information, or visit biolegend.com/totalseq.
The barcode flanking sequences are CCTTGGCACCCGAGAATTCCA (PCR handle), and BAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA*A*A (capture sequence). B represents either C, G, or T, and * indicates a phosphorothioated bond, to prevent nuclease degradation.
View more applications data for this product in our Scientific Poster Library. -
Application References
(PubMed link indicates BioLegend citation) -
- Kersh G, et al. 1998. J Immunol. 161:585-93.
- RRID
-
AB_2892320 (BioLegend Cat. No. 156307)
Antigen Details
- Structure
- Ig super family; TCR is an 85-kd hetero-dimer composed of alpha and beta chain.
- Distribution
-
Expressed in a subset of αβ T cells
- Function
- Recognition of Peptide/MHC, T cell activation
- Interaction
- CD3
- Ligand/Receptor
- Peptide/MHC complex
- Cell Targets
- CD3
- Cell Type
- T cells
- Biology Area
- Adaptive Immunity, Immunology
- Molecular Family
- TCRs
- Antigen References
-
- Haskins K, et al. 1984. J Exp Med. 160:452-71.
- Davis MM, et al. 1998. Annu Rev Immunol. 16:523-44.
- Kersh GJ, et al. 1998. J Immunol. 161:585-93.
- Tomonari K. 1996. Immunogenetics. 44:73-5.
- Gene ID
- 21577 View all products for this Gene ID
- UniProt
- View information about TCR Vbeta8.3 on UniProt.org
Other Formats
View All TCR vbeta8.3 Reagents Request Custom Conjugation| Description | Clone | Applications |
|---|---|---|
| Purified anti-mouse TCR vβ8.3 | 1B3.3 | FC |
| PE anti-mouse TCR vβ8.3 | 1B3.3 | FC |
| FITC anti-mouse TCR vβ8.3 | 1B3.3 | FC |
| TotalSeq™-A1139 anti-mouse TCR vβ8.3 | 1B3.3 | PG |
Compare Data Across All Formats
This data display is provided for general comparisons between formats.
Your actual data may vary due to variations in samples, target cells, instruments and their settings, staining conditions, and other factors.
If you need assistance with selecting the best format contact our expert technical support team.
-
Purified anti-mouse TCR vβ8.3
C57BL/6 mouse splenocytes were stained with purified anti-mo... -
PE anti-mouse TCR vβ8.3
C57BL/6 mouse splenocytes were stained with CD3 APC and anti... -
FITC anti-mouse TCR vβ8.3
C57BL/6 mouse splenocytes were stained with CD3 APC and anti... -
TotalSeq™-A1139 anti-mouse TCR vβ8.3