- Clone
- OKT3 (See other available formats)
- Regulatory Status
- RUO
- Workshop
- HCDM listed
- Other Names
- T3, CD3ε
- Isotype
- Mouse IgG2a, κ
- Barcode Sequence
- GATGTATTCCTTCGT
Cat # | Size | Price | Quantity Check Availability | ||
---|---|---|---|---|---|
317363 | 10 µg | $369.00 |
CD3ε is a 20 kD chain of the CD3/T cell receptor (TCR) complex, which is composed of two CD3ε, one CD3γ, one CD3δ, one CD3ζ (CD247), and a T cell receptor (α/β or γ/δ) heterodimer. It is found on all mature T lymphocytes, NK T cells, and some thymocytes. CD3, also known as T3, is a member of the immunoglobulin superfamily that plays a role in antigen recognition, signal transduction, and T cell activation.
Product Details
- Verified Reactivity
- Human
- Antibody Type
- Monoclonal
- Host Species
- Mouse
- Formulation
- Phosphate-buffered solution, pH 7.2, containing 0.09% sodium azide and EDTA
- Preparation
- The antibody was purified by chromatography and conjugated with TotalSeq™-A oligomer under optimal conditions.
- Concentration
- 0.5 mg/mL
- Storage & Handling
- The antibody solution should be stored undiluted between 2°C and 8°C. Do not freeze.
- Application
-
PG - Quality tested
- Recommended Usage
-
Each lot of this antibody is quality control tested by immunofluorescent staining with flow cytometric analysis and the oligomer sequence is confirmed by sequencing. TotalSeq™-A antibodies are compatible with 10x Genomics Single Cell Gene Expression Solutions.
To maximize performance, it is strongly recommended that the reagent be titrated for each application, and that you centrifuge the antibody dilution before adding to the cells at 14,000xg at 2 - 8°C for 10 minutes. Carefully pipette out the liquid avoiding the bottom of the tube and add to the cell suspension. For Proteogenomics analysis, the suggested starting amount of this reagent for titration is ≤ 1.0 µg per million cells in 100 µL volume. Refer to the corresponding TotalSeq™ protocol for specific staining instructions.
Buyer is solely responsible for determining whether Buyer has all intellectual property rights that are necessary for Buyer's intended uses of the BioLegend TotalSeq™ products. For example, for any technology platform Buyer uses with TotalSeq™, it is Buyer's sole responsibility to determine whether it has all necessary third party intellectual property rights to use that platform and TotalSeq™ with that platform. - Application Notes
-
The OKT3 monoclonal antibody reacts with an epitope on the epsilon-subunit within the human CD3 complex.
Clone OKT3 can block the binding of clones SK7 and UCHT1.4 The OKT3 antibody is able to induce T cell activation. Additional reported applications (for the relevant formats) include: immunohistochemical staining of acetone-fixed frozen sections and activation of T cells. The LEAF™ purified antibody (Endotoxin <0.1 EU/µg, Azide-Free, 0.2 µm filtered) is recommended for functional assays (Cat. No. 317304). For highly sensitive assays, we recommend Ultra-LEAF™ purified antibody (Cat. No. 317326) with a lower endotoxin limit than standard LEAF™ purified antibodies (Endotoxin <0.01 EU/µg). - Additional Product Notes
-
TotalSeq™ reagents are designed to profile protein levels at a single cell level following an optimized protocol similar to the CITE-seq workflow. A compatible single cell device (e.g. 10x Genomics Chromium System and Reagents) and sequencer (e.g. Illumina analyzers) are required. Please contact technical support for more information, or visit biolegend.com/totalseq.
The barcode flanking sequences are CCTTGGCACCCGAGAATTCCA (PCR handle), and BAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA*A*A (capture sequence). B represents either C, G, or T, and * indicates a phosphorothioated bond, to prevent nuclease degradation.
View more applications data for this product in our Scientific Poster Library. -
Application References
(PubMed link indicates BioLegend citation) -
- Schlossman S, et al. Eds. 1995. Leucocyte Typing V. Oxford University Press. New York.
- Knapp W. 1989. Leucocyte Typing IV. Oxford University Press New York.
- Barclay N, et al. 1997. The Leucocyte Antigen Facts Book. Academic Press Inc. San Diego.
- Li B, et al. 2005. Immunology 116:487.
- Jeong HY, et al. 2008. J. Leuckocyte Biol. 83:755. PubMed
- Alter G, et al. 2008. J. Virol. 82:9668. PubMed
- Manevich-Mendelson E, et al. 2009. Blood 114:2344. PubMed
- Pinto JP, et al. 2010. Immunology. 130:217. PubMed
- Biggs MJ, et al. 2011. J. R. Soc. Interface. 8:1462. PubMed
- RRID
-
AB_3083174 (BioLegend Cat. No. 317363)
Antigen Details
- Structure
- Ig superfamily, the subunits CD3γ, CD3δ, CD3ζ (CD247) and TCR (α/β or γ/δ) form the CD3/TCR complex, 20 kD
- Distribution
-
Mature T and NK T cells, thymocyte differentiation
- Function
- Antigen recognition, signal transduction, T cell activation
- Ligand/Receptor
- Peptide antigen bound to MHC
- Cell Type
- NKT cells, T cells, Thymocytes, Tregs
- Biology Area
- Immunology
- Molecular Family
- CD Molecules
- Antigen References
-
- Barclay N, et al. 1993. The Leucocyte FactsBook. Academic Press. San Diego.
- Beverly P, et al. 1981. Eur. J. Immunol. 11:329.
- Lanier L, et al. 1986. J. Immunol. 137:2501.
- Gene ID
- 916 View all products for this Gene ID
- UniProt
- View information about CD3 on UniProt.org
Other Formats
View All CD3 Reagents Request Custom ConjugationCompare Data Across All Formats
This data display is provided for general comparisons between formats.
Your actual data may vary due to variations in samples, target cells, instruments and their settings, staining conditions, and other factors.
If you need assistance with selecting the best format contact our expert technical support team.
-
Purified anti-human CD3
-
FITC anti-human CD3
-
PE anti-human CD3
-
Alexa Fluor® 488 anti-human CD3
-
Alexa Fluor® 647 anti-human CD3
-
Pacific Blue™ anti-human CD3
-
APC anti-human CD3
-
Biotin anti-human CD3
-
Brilliant Violet 605™ anti-human CD3
-
Brilliant Violet 650™ anti-human CD3
-
Ultra-LEAF™ Purified anti-human CD3
-
Brilliant Violet 711™ anti-human CD3
-
Brilliant Violet 785™ anti-human CD3
-
Brilliant Violet 510™ anti-human CD3
-
PE/Cyanine7 anti-human CD3
-
PerCP/Cyanine5.5 anti-human CD3
-
PerCP anti-human CD3
-
Alexa Fluor® 700 anti-human CD3
-
APC/Cyanine7 anti-human CD3
-
Brilliant Violet 421™ anti-human CD3
-
PE/Dazzle™ 594 anti-human CD3
-
APC/Fire™ 750 anti-human CD3
-
GMP Ultra-LEAF™ Purified anti-human CD3 SF
-
PE/Cyanine5 anti-human CD3 Antibody
-
GMP Ultra-LEAF™ Biotin anti-human CD3 SF
-
Spark UV™ 387 anti-human CD3
-
Spark Red™ 718 anti-human CD3
-
TotalSeq™-A1289 anti-human CD3
-
TotalSeq™-B1289 anti-human CD3
-
TotalSeq™-C1289 anti-human CD3