- Clone
- W20047C (See other available formats)
- Regulatory Status
- RUO
- Other Names
- Gp34, OX40L, CD134L, CD252, TNFSF4
- Isotype
- Rat IgG2a, κ
- Barcode Sequence
- CTTTCCCGGATGTAC
Cat # | Size | Price | Quantity Check Availability | ||
---|---|---|---|---|---|
389205 | 10 µg | $369.00 |
OX40 ligand (OX40L), also known as gp34, CD252, CD134L or TNFSF4, is a 35 kD type II transmembrane protein which belongs to TNF superfamily. The OX40 ligand is expressed on activated B cells, activated endothelial cells, mature dendritic cells, activated CTLs, activated mast cells, and airway smooth muscle cells. OX40 ligand interacts with OX40 antigen (CD134) expressed predominantly on activated T cells to regulate T cell proliferation and differentiation, and to enhance immunoglobulin secretion by activated B cells.
Product Details
- Verified Reactivity
- Human
- Antibody Type
- Monoclonal
- Host Species
- Rat
- Immunogen
- Recombinant human OX40L protein
- Formulation
- Phosphate-buffered solution, pH 7.2, containing 0.09% sodium azide and EDTA
- Preparation
- The antibody was purified by chromatography and conjugated with TotalSeq™-A oligomer under optimal conditions.
- Concentration
- 0.5 mg/mL
- Storage & Handling
- The antibody solution should be stored undiluted between 2°C and 8°C. Do not freeze.
- Application
-
PG - Quality tested
- Recommended Usage
-
Each lot of this antibody is quality control tested by immunofluorescent staining with flow cytometric analysis and the oligomer sequence is confirmed by sequencing. TotalSeq™-A antibodies are compatible with 10x Genomics Single Cell Gene Expression Solutions.
To maximize performance, it is strongly recommended that the reagent be titrated for each application, and that you centrifuge the antibody dilution before adding to the cells at 14,000xg at 2 - 8°C for 10 minutes. Carefully pipette out the liquid avoiding the bottom of the tube and add to the cell suspension. For Proteogenomics analysis, the suggested starting amount of this reagent for titration is ≤ 1.0 µg per million cells in 100 µL volume. Refer to the corresponding TotalSeq™ protocol for specific staining instructions.
Buyer is solely responsible for determining whether Buyer has all intellectual property rights that are necessary for Buyer's intended uses of the BioLegend TotalSeq™ products. For example, for any technology platform Buyer uses with TotalSeq™, it is Buyer's sole responsibility to determine whether it has all necessary third party intellectual property rights to use that platform and TotalSeq™ with that platform. - Additional Product Notes
-
TotalSeq™ reagents are designed to profile protein levels at a single cell level following an optimized protocol similar to the CITE-seq workflow. A compatible single cell device (e.g. 10x Genomics Chromium System and Reagents) and sequencer (e.g. Illumina analyzers) are required. Please contact technical support for more information, or visit biolegend.com/totalseq.
The barcode flanking sequences are CCTTGGCACCCGAGAATTCCA (PCR handle), and BAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA*A*A (capture sequence). B represents either C, G, or T, and * indicates a phosphorothioated bond, to prevent nuclease degradation.
View more applications data for this product in our Scientific Poster Library. - RRID
-
AB_3662401 (BioLegend Cat. No. 389205)
Antigen Details
- Structure
- NGF/TNF superfamily, 35 kD
- Distribution
-
Activated B cells, activated endothelial cells, mature dendritic cells, airway smooth muscle cells
- Function
- T-cell interaction, costimulation
- Ligand/Receptor
- OX40 (CD134)
- Cell Type
- B cells, Dendritic cells, Endothelial cells
- Biology Area
- Costimulatory Molecules, Immunology
- Molecular Family
- CD Molecules, Immune Checkpoint Receptors
- Antigen References
-
- Imura A, et al. 1996. J Exp Med. 183:2185-95.
- Ohshima Y, et al. 1997. J Immunol. 159:3838-48.
- Ito T, et al. 2005. J Exp Med. 202:1213-23.
- Ito T, et al. 2006. Proc Natl Acad.Sci. USA. 103:13138.
- Gene ID
- 7292 View all products for this Gene ID
- UniProt
- View information about CD252 on UniProt.org
Other Formats
View All CD252 Reagents Request Custom ConjugationDescription | Clone | Applications |
---|---|---|
Purified anti-human CD252 (OX40L) | W20047C | FC |
PE anti-human CD252 (OX40L) | W20047C | FC |
TotalSeq™-A1463 anti-human CD252 (OX40L) | W20047C | PG |
TotalSeq™-C1463 anti-human CD252 (OX40L) Antibody | W20047C | PG |
Compare Data Across All Formats
This data display is provided for general comparisons between formats.
Your actual data may vary due to variations in samples, target cells, instruments and their settings, staining conditions, and other factors.
If you need assistance with selecting the best format contact our expert technical support team.