TotalSeq™-D0034 anti-human CD3 antibody, CD3, UCHT1

Pricing & Availability

Clone: UCHT1 (See other available formats)
Regulatory Status: RUO
Workshop: III 471
Other Names: T3, CD3ε
Isotype: Mouse IgG1, κ
Barcode Sequence: CTCATTGTAACTCCT

Compare all formats

Cat #

Size

Price

Quantity Check Availability

300485

10 µg

$369.00

Check Availability

Need larger quantities of this item?
Request Bulk Quote

Description

CD3ε is a 20 kD chain of the CD3/T-cell receptor (TCR) complex which is composed of two CD3ε, one CD3γ, one CD3δ, one CD3ζ (CD247), and a T-cell receptor (α/β or γ/δ) heterodimer. It is found on all mature T cells, NKT cells, and some thymocytes. CD3, also known as T3, is a member of the immunoglobulin superfamily that plays a role in antigen recognition, signal transduction, and T cell activation.

Technical data sheet

Product Details

Verified Reactivity

Human

Reported Reactivity

Chimpanzee

Antibody Type

Monoclonal

Host Species

Mouse

Formulation

Phosphate-buffered solution, pH 7.2, containing 0.09% sodium azide and EDTA

Preparation

The antibody was purified by chromatography and conjugated with TotalSeq™-D oligomer under optimal conditions.

Concentration

0.5 mg/mL

Storage & Handling

The antibody solution should be stored undiluted between 2°C and 8°C. Do not freeze.

Application

PG - Quality tested

Recommended Usage

Each lot of this antibody is quality control tested by immunofluorescent staining with flow cytometric analysis and the oligomer sequence is confirmed by sequencing. TotalSeq™-D antibodies are compatible with Mission Bio’s Tapestri Single-Cell Sequencing Platform for simultaneous detection of DNA and Protein.

To maximize performance, it is strongly recommended that the reagent be titrated for each application, and that you centrifuge the antibody dilution before adding to the cells at 14,000xg at 2 - 8°C for 10 minutes. Carefully pipette out the liquid avoiding the bottom of the tube and add to the cell suspension. For Proteogenomics analysis, the suggested starting amount of this reagent for titration is ≤ 1.0 µg per million cells in 100 µL volume. Refer to the corresponding TotalSeq™ protocol for specific staining instructions.

Buyer is solely responsible for determining whether Buyer has all intellectual property rights that are necessary for Buyer's intended uses of the BioLegend TotalSeq™ products. For example, for any technology platform Buyer uses with TotalSeq™, it is Buyer's sole responsibility to determine whether it has all necessary third party intellectual property rights to use that platform and TotalSeq™ with that platform.

Application Notes

Additional reported applications (for the relevant formats) include: immunohistochemical staining of acetone-fixed frozen sections^4,6,7 and formalin-fixed paraffin-embedded sections¹¹, immunoprecipitation¹, activation of T cells^2,3,5, Western blotting⁹, and spatial biology (IBEX)^16,17. The LEAF™ purified antibody (Endotoxin < 0.1 EU/µg, Azide-Free, 0.2 µm filtered) is recommended for functional assays (Cat. No. 300413, 300414, and 300432). For highly sensitive assays, we recommend Ultra-LEAF™ purified antibody (Cat. No. 300437, 300438, 300465, 300466, 300473, 300474) with a lower endotoxin limit than standard LEAF™ purified antibodies (Endotoxin < 0.01 EU/µg).

Additional Product Notes

TotalSeq™-D reagents are designed to profile protein expression at single cell level. The Mission Bio Tapestri platform and sequencer (e.g. Illumina analyzers) are required. Please contact technical support for more information, or visit biolegend.com/totalseq/single-cell-dna

The barcode flanking sequences are CGAGATGACTACGCTACTCATGG (PCR handle), and GAGCCGATCTAGTATCTCAGT*C*G (capture sequence). * indicates a phosphorothioated bond, to prevent nuclease degradation.

View more applications data for this product in our Application Technical Notes.

Application References (PubMed link indicates BioLegend citation)

Salmeron A, et al. 1991. J. Immunol. 147:3047. (IP)
Graves J, et al. 1991. J. Immunol. 146:2102. (Activ)
Lafont V, et al. 2000. J. Biol. Chem. 275:19282. (Activ)
Ryschich E, et al. 2003. Tissue Antigens 62:48. (IHC)
Thompson AG, et al. 2004. J. Immunol. 173:1671. (Activ)
Sakkas LI, et al. 1998. Clin. Diagn. Lab. Immun. 5:430. (IHC)
Mack CL, et al. 2004. Pediatr. Res. 56:79. (IHC)
Thakral D, et al. 2008. J. Immunol. 180:7431. (FC) PubMed
Van Dongen JJM, et al. 1988. Blood 71:603. (WB)
Yoshino N, et al. 2000. Exp. Anim. (Tokyo) 49:97. (FC)
Pollard, K. et al. 1987. J. Histochem. Cytochem. 35:1329. (IHC)
Luckashenak N, et al. 2013. J. Immunol. 190:27. PubMed
Laurent AJ, et al. 2014. PLoS One. 9:103683. PubMed
Li J, et al. 2015. Cancer Res. 75:508. PubMed
Stoeckius M, et al. 2017. Nat. Methods. 14:865-868. (PG)
Radtke AJ, et al. 2020. Proc Natl Acad Sci USA. 117:33455-33465. (SB) PubMed
Radtke AJ, et al. 2022. Nat Protoc. 17:378-401. (SB) PubMed

RRID

AB_2892342 (BioLegend Cat. No. 300485)

Antigen Details

Structure: Ig superfamily, with the subunits of CD3γ, CD3δ, CD3ζ (CD247) and TCR (α/β or γ/δ) forms CD3/TCR complex, 20 kD
Distribution: Mature T and NK T cells, thymocyte differentiation
Function: Antigen recognition, signal transduction, T cell activation
Ligand/Receptor: Peptide antigen bound to MHC
Cell Type: NKT cells, T cells, Thymocytes, Tregs
Biology Area: Immunology, Innate Immunity
Molecular Family: CD Molecules, TCRs
Antigen References: 1. Barclay N, et al. 1993. The Leucocyte FactsBook. Academic Press. San Diego.
2. Beverly P, et al. 1981. Eur. J. Immunol. 11:329.
3. Lanier L, et al. 1986. J. Immunol. 137:2501-2507.
Gene ID: 916 View all products for this Gene ID
UniProt: View information about CD3 on UniProt.org

Related Protocols

TotalSeq™-D with Mission Bio Tapestri® Single-Cell DNA + Protein Protocol

Related Products

Description	Clone	Applications

Other Formats

View All CD3 Reagents Request Custom Conjugation

Description	Clone	Applications
APC anti-human CD3	UCHT1	FC
Biotin anti-human CD3	UCHT1	FC
FITC anti-human CD3	UCHT1	FC
PE anti-human CD3	UCHT1	FC
PE/Cyanine5 anti-human CD3	UCHT1	FC
Purified anti-human CD3	UCHT1	FC,CyTOF®,IHC-F,IP,Activ,WB
Alexa Fluor® 647 anti-human CD3	UCHT1	FC,ICC,IHC-F
Alexa Fluor® 488 anti-human CD3	UCHT1	FC,ICC,IHC-F
Pacific Blue™ anti-human CD3	UCHT1	FC
PE/Cyanine7 anti-human CD3	UCHT1	FC
Alexa Fluor® 700 anti-human CD3	UCHT1	FC
APC/Cyanine7 anti-human CD3	UCHT1	FC
PerCP anti-human CD3	UCHT1	FC
PerCP/Cyanine5.5 anti-human CD3	UCHT1	FC
Brilliant Violet 421™ anti-human CD3	UCHT1	FC,ICC,IHC-F
Brilliant Violet 570™ anti-human CD3	UCHT1	FC
Ultra-LEAF™ Purified anti-human CD3	UCHT1	FC,CyTOF®,IHC-F,IP,Activ,WB
Purified anti-human CD3 (Maxpar® Ready)	UCHT1	FC,CyTOF®
Alexa Fluor® 594 anti-human CD3	UCHT1	ICC,FC,SB
PE/Dazzle™ 594 anti-human CD3	UCHT1	FC
Brilliant Violet 510™ anti-human CD3	UCHT1	FC
Brilliant Violet 605™ anti-human CD3	UCHT1	FC
Brilliant Violet 711™ anti-human CD3	UCHT1	FC
Brilliant Violet 650™ anti-human CD3	UCHT1	FC
APC/Fire™ 750 anti-human CD3	UCHT1	FC
Pacific Blue™ anti-human CD3	UCHT1	FC
Brilliant Violet 785™ anti-human CD3	UCHT1	FC
PE/Dazzle™ 594 anti-human CD3	UCHT1	FC
TotalSeq™-A0034 anti-human CD3	UCHT1	PG
TotalSeq™-B0034 anti-human CD3	UCHT1	PG
TotalSeq™-C0034 anti-human CD3	UCHT1	PG
PE anti-human CD3	UCHT1	FC
PE/Cyanine7 anti-human CD3	UCHT1	FC
KIRAVIA Blue 520™ anti-human CD3	UCHT1	FC
Spark Violet™ 538 anti-human CD3 Antibody	UCHT1	FC
TotalSeq™-D0034 anti-human CD3	UCHT1	PG
Spark Blue™ 574 anti-human CD3 Antibody	UCHT1	FC
GMP Pacific Blue™ anti-human CD3	UCHT1	FC
GMP PE anti-human CD3	UCHT1	FC
GMP PE/Dazzle™ 594 anti-human CD3	UCHT1	FC
Spark Violet™ 423 anti-human CD3	UCHT1	FC
GMP PE/Cyanine7 anti-human CD3	UCHT1	FC
Spark Blue™ 515 anti-human CD3	UCHT1	FC

Go To Top Version: 1 Revision Date: 05/24/2021

8999 BioLegend Way, San Diego, CA 92121 www.biolegend.com
Toll-Free Phone: 1-877-Bio-Legend (246-5343) Phone: (858) 768-5800 Fax: (877) 455-9587

This data display is provided for general comparisons between formats.
Your actual data may vary due to variations in samples, target cells, instruments and their settings, staining conditions, and other factors.
If you need assistance with selecting the best format contact our expert technical support team.