TotalSeq™-D0047 anti-human CD56 (NCAM) Antibody

Pricing & Availability
Clone
5.1H11 (See other available formats)
Regulatory Status
RUO
Other Names
Leu-19, NKH1, NCAM-1
Isotype
Mouse IgG1, κ
Barcode Sequence
TCCTTTCCTGATAGG
Ave. Rating
Submit a Review
Product Citations
publications
Cat # Size Price Quantity Check Availability Save
362567 10 µg 369 CHF
Check Availability


Need larger quantities of this item?
Request Bulk Quote
Description

CD56 is a single transmembrane glycoprotein also known as NCAM (neural cell adhesion molecule), Leu-19, or NKH1. It is a member of the Ig superfamily. The 140 kD isoform is expressed on NK and NKT cells. CD56 is also expressed in the brain (cerebellum and cortex) and at neuromuscular junctions. Certain large granular lymphocyte (LGL) leukemias, small-cell lung carcinomas, neuronal derived tumors, myelomas, and myeloid leukemias also express CD56. CD56 plays a role in homophilic and heterophilic adhesion via binding to itself or heparan sulfate.

Product Details
Technical Data Sheet (pdf)

Product Details

Verified Reactivity
Human
Antibody Type
Monoclonal
Host Species
Mouse
Immunogen
Human myotube cells
Formulation
Phosphate-buffered solution, pH 7.2, containing 0.09% sodium azide and EDTA
Preparation
The antibody was purified by chromatography and conjugated with TotalSeq™-D oligomer under optimal conditions.
Concentration
0.5 mg/mL
Storage & Handling
The antibody solution should be stored undiluted between 2°C and 8°C. Do not freeze.
Application

PG - Quality tested

Recommended Usage

Each lot of this antibody is quality control tested by immunofluorescent staining with flow cytometric analysis and the oligomer sequence is confirmed by sequencing. TotalSeq™-D antibodies are compatible with Mission Bio’s Tapestri Single-Cell Sequencing Platform for simultaneous detection of DNA and Protein.

To maximize performance, it is strongly recommended that the reagent be titrated for each application, and that you centrifuge the antibody dilution before adding to the cells at 14,000xg at 2 - 8°C for 10 minutes. Carefully pipette out the liquid avoiding the bottom of the tube and add to the cell suspension. For Proteogenomics analysis, the suggested starting amount of this reagent for titration is ≤ 1.0 µg per million cells in 100 µL volume. Refer to the corresponding TotalSeq™ protocol for specific staining instructions.

 


Buyer is solely responsible for determining whether Buyer has all intellectual property rights that are necessary for Buyer's intended uses of the BioLegend TotalSeq™ products. For example, for any technology platform Buyer uses with TotalSeq™, it is Buyer's sole responsibility to determine whether it has all necessary third party intellectual property rights to use that platform and TotalSeq™ with that platform.
Additional Product Notes

TotalSeq™-D reagents are designed to profile protein expression at single cell level. The Mission Bio Tapestri platform and sequencer (e.g. Illumina analyzers) are required. Please contact technical support for more information, or visit biolegend.com/totalseq/single-cell-dna

The barcode flanking sequences are CGAGATGACTACGCTACTCATGG (PCR handle), and GAGCCGATCTAGTATCTCAGT*C*G (capture sequence). * indicates a phosphorothioated bond, to prevent nuclease degradation.

View more applications data for this product in our Application Technical Notes.

Application References

(PubMed link indicates BioLegend citation)
  1. Walsh FS, et al. 1981. Nature 289:60. (FC)
  2. Pavlath GK, et al. 1986. J. Cell Biol. 102:124. (FC)
  3. Pavlath GK, et al. 1989. Nature 337:570. (FC)
  4. Pulido R, et al. 1988. J. Immunol. 140:3851. (FC)
RRID
AB_2904383 (BioLegend Cat. No. 362567)

Antigen Details

Structure
Ig superfamily, single transmembrane or GPI-anchored glycoprotein
Distribution

NK cells, T subset, neural tissue, some LGL and myeloid leukemias

Function
Adhesion
Ligand/Receptor
Heparan sulfate
Antigen References

1. Lanier L, et al. 1991. J. Immunol. 146:4421
2. Hemperly J, et al. 1990. J. Mol. Neurosci. 2:71
3. Cremer H, et al. 1994. Nature 367:455.

Gene ID
4684 View all products for this Gene ID
UniProt
View information about CD56 on UniProt.org

Related FAQs

There are no FAQs for this product.

Other Formats

View All CD56 (NCAM) Reagents Request Custom Conjugation
Description Clone Applications
Purified anti-human CD56 (NCAM) 5.1H11 FC
APC anti-human CD56 (NCAM) 5.1H11 FC
PerCP/Cyanine5.5 anti-human CD56 (NCAM) 5.1H11 FC
PE anti-human CD56 (NCAM) 5.1H11 FC
PE/Cyanine7 anti-human CD56 (NCAM) 5.1H11 FC
APC/Cyanine7 anti-human CD56 (NCAM) 5.1H11 FC
PE/Cyanine5 anti-human CD56 (NCAM) 5.1H11 FC
Alexa Fluor® 647 anti-human CD56 (NCAM) 5.1H11 FC
Alexa Fluor® 488 anti-human CD56 (NCAM) 5.1H11 FC
Pacific Blue™ anti-human CD56 (NCAM) 5.1H11 FC
Alexa Fluor® 700 anti-human CD56 (NCAM) 5.1H11 FC
PerCP anti-human CD56 (NCAM) 5.1H11 FC
Brilliant Violet 650™ anti-human CD56 (NCAM) 5.1H11 FC
Brilliant Violet 510™ anti-human CD56 (NCAM) 5.1H11 FC
Brilliant Violet 421™ anti-human CD56 (NCAM) 5.1H11 FC
Biotin anti-human CD56 (NCAM) 5.1H11 FC
Brilliant Violet 605™ anti-human CD56 (NCAM) 5.1H11 FC
Brilliant Violet 570™ anti-human CD56 (NCAM) 5.1H11 FC
Brilliant Violet 711™ anti-human CD56 (NCAM) 5.1H11 FC
PE/Dazzle™ 594 anti-human CD56 (NCAM) 5.1H11 FC
FITC anti-human CD56 (NCAM) 5.1H11 FC
Brilliant Violet 785™ anti-human CD56 (NCAM) 5.1H11 FC
Ultra-LEAF™ Purified anti-human CD56 (NCAM) 5.1H11 FC
APC/Fire™ 750 anti-human CD56 (NCAM) 5.1H11 FC
PE anti-human CD56 (NCAM) 5.1H11 FC
APC anti-human CD56 (NCAM) 5.1H11 FC
Brilliant Violet 750™ anti-human CD56 (NCAM) 5.1H11 FC
TotalSeq™-A0047 anti-human CD56 (NCAM) 5.1H11 PG
TotalSeq™-C0047 anti-human CD56 (NCAM) 5.1H11 PG
TotalSeq™-B0047 anti-human CD56 (NCAM) 5.1H11 PG
Spark NIR™ 685 anti-human CD56 (NCAM) 5.1H11 FC
KIRAVIA Blue 520™ anti-human CD56 (NCAM) 5.1H11 FC
GMP PE anti-human CD56 (NCAM) 5.1H11 FC
TotalSeq™-D0047 anti-human CD56 (NCAM) 5.1H11 PG
GMP APC anti-human CD56 (NCAM) 5.1H11 FC
Spark YG™ 593 anti-human CD56 (NCAM) 5.1H11 FC
Cell-Vive™ GMP Ultra-LEAF™ Purified anti-human CD56 (NCAM) SF 5.1H11 FC
Spark Red™ 718 anti-human CD56 (NCAM) 5.1H11 FC
Cell-Vive™ GMP Ultra-LEAF™ Biotin anti-human CD56 (NCAM) SF 5.1H11 FC
Go To Top Version: 1    Revision Date: 11.05.2021

For Research Use Only. Not for diagnostic or therapeutic use.

 

This product is supplied subject to the terms and conditions, including the limited license, located at www.biolegend.com/terms) ("Terms") and may be used only as provided in the Terms. Without limiting the foregoing, BioLegend products may not be used for any Commercial Purpose as defined in the Terms, resold in any form, used in manufacturing, or reverse engineered, sequenced, or otherwise studied or used to learn its design or composition without express written approval of BioLegend. Regardless of the information given in this document, user is solely responsible for determining any license requirements necessary for user’s intended use and assumes all risk and liability arising from use of the product. BioLegend is not responsible for patent infringement or any other risks or liabilities whatsoever resulting from the use of its products.

 

BioLegend, the BioLegend logo, and all other trademarks are property of BioLegend, Inc. or their respective owners, and all rights are reserved.

 

8999 BioLegend Way, San Diego, CA 92121 www.biolegend.com
Toll-Free Phone: 1-877-Bio-Legend (246-5343) Phone: (858) 768-5800 Fax: (877) 455-9587

This data display is provided for general comparisons between formats.
Your actual data may vary due to variations in samples, target cells, instruments and their settings, staining conditions, and other factors.
If you need assistance with selecting the best format contact our expert technical support team.

ProductsHere

Login / Register
Remember me
Forgot your password? Reset password?
Create an Account