TotalSeq™-D0083 anti-human CD16 antibody, CD16, 3G8

Pricing & Availability

Clone: 3G8 (See other available formats)
Regulatory Status: RUO
Workshop: V NK80
Other Names: FcγRIII, Fc gamma receptor, Fc gamma receptor 3
Isotype: Mouse IgG1, κ
Barcode Sequence: AAGTTCACTCTTTGC
Ave. Rating: Submit a Review
Product Citations: publications

Compare all formats

Cat #

Size

Price

Quantity Check Availability

Save

302071

10 µg

369 CHF

Check Availability

Need larger quantities of this item?
Request Bulk Quote

Description

CD16 is known as low affinity IgG receptor III (FcγRIII). It is expressed as two distinct forms (CD16a and CD16b). CD16a (FcγRIIIA) is a 50-65 kD polypeptide-anchored transmembrane protein. It is expressed on the surface of NK cells, activated monocytes, macrophages, and placental trophoblasts in humans. CD16b (FcγRIIIB) is a 48 kD glycosylphosphatidylinositol (GPI)-anchored protein. Its extracellular domain is over 95% homologous to that of CD16a, and it is expressed specifically on neutrophils. CD16 binds aggregated IgG or IgG-antigen complex which functions in NK cell activation, phagocytosis, and antibody-dependent cell-mediated cytotoxicity (ADCC).

Product Details

Technical Data Sheet (pdf)

Product Details

Verified Reactivity: Human, Cynomolgus, Rhesus
Reported Reactivity: African Green, Baboon, Capuchin Monkey, Chimpanzee, Common Marmoset, Pigtailed Macaque, Sooty Mangabey, Squirrel Monkey
Antibody Type: Monoclonal
Host Species: Mouse
Immunogen: Human PMN cells
Formulation: Phosphate-buffered solution, pH 7.2, containing 0.09% sodium azide and EDTA
Preparation: The antibody was purified by chromatography and conjugated with TotalSeq™-D oligomer under optimal conditions.
Concentration: 0.5 mg/mL
Storage & Handling: The antibody solution should be stored undiluted between 2°C and 8°C. Do not freeze.
Application: PG - Quality tested
Recommended Usage: Each lot of this antibody is quality control tested by immunofluorescent staining with flow cytometric analysis and the oligomer sequence is confirmed by sequencing. TotalSeq™-D antibodies are compatible with Mission Bio’s Tapestri Single-Cell Sequencing Platform for simultaneous detection of DNA and Protein.

To maximize performance, it is strongly recommended that the reagent be titrated for each application, and that you centrifuge the antibody dilution before adding to the cells at 14,000xg at 2 - 8°C for 10 minutes. Carefully pipette out the liquid avoiding the bottom of the tube and add to the cell suspension. For Proteogenomics analysis, the suggested starting amount of this reagent for titration is ≤ 1.0 µg per million cells in 100 µL volume. Refer to the corresponding TotalSeq™ protocol for specific staining instructions.

Buyer is solely responsible for determining whether Buyer has all intellectual property rights that are necessary for Buyer's intended uses of the BioLegend TotalSeq™ products. For example, for any technology platform Buyer uses with TotalSeq™, it is Buyer's sole responsibility to determine whether it has all necessary third party intellectual property rights to use that platform and TotalSeq™ with that platform.
Application Notes: The 3G8 antibody clone blocks neutrophil phagocytosis and stimulates NK cell proliferation. It has been reported that this clone interacts with the FcγRIIa and FcγRIIIb receptors causing neutrophil activation and aggregation¹⁸. Due to this phenomenon staining in whole blood may cause a reduction in the number of granulocytes or alter their scatter profile.

Additional reported applications (for the relevant formats) include: immunohistochemical staining of acetone-fixed frozen tissue sections⁶, immunoprecipitation³, stimulation of NK cell proliferation⁴, blocking of phagocytosis⁵, and blocking of immunoglobulin binding to FcγRIII^7,8. The Ultra-LEAF™ purified antibody (Endotoxin < 0.01 EU/µg, Azide-Free, 0.2 µm filtered) is recommended for functional assays (Cat. No. 302049, 302050, 302057, 302058).
Additional Product Notes: TotalSeq™-D reagents are designed to profile protein expression at single cell level. The Mission Bio Tapestri platform and sequencer (e.g. Illumina analyzers) are required. Please contact technical support for more information, or visit biolegend.com/totalseq/single-cell-dna

The barcode flanking sequences are CGAGATGACTACGCTACTCATGG (PCR handle), and GAGCCGATCTAGTATCTCAGT*C*G (capture sequence). * indicates a phosphorothioated bond, to prevent nuclease degradation.

View more applications data for this product in our Application Technical Notes.
RRID: AB_2892348 (BioLegend Cat. No. 302071)

Antigen Details

Structure: Ig superfamily, transmembrane form (50-65 kD) or GPI-linked form (48 kD)
Distribution: NK cells, activated monocytes, macrophages, neutrophils
Function: Low affinity IgG Fc receptor, phagocytosis, ADCC
Ligand/Receptor: Aggregated IgG, IgG-antigen complex
Cell Type: Dendritic cells, Macrophages, Monocytes, Neutrophils, NK cells
Biology Area: Immunology, Innate Immunity
Molecular Family: CD Molecules, Fc Receptors
Antigen References: 1. Fleit H, et al. 1982. P. Natl. Acad. Sci. USA 79:3275.
2. Stroncek D, et al. 1991. Blood 77:1572.
3. Wirthmueller U, et al. 1992. J. Exp. Med. 175:1381.
Gene ID: 2214 View all products for this Gene ID
UniProt: View information about CD16 on UniProt.org

Documentation

Reviews

Review This Product

Related Protocols

TotalSeq™-D with Mission Bio Tapestri® Single-Cell DNA + Protein Protocol

Related Products

Description	Clone	Applications

Related Pages & Pathways

Pathways

Myeloid-Derived Suppressor Cells

Related FAQs

Is our human Trustain FcX™ (cat# 422302) compatible with anti human CD16, CD32 and CD64 clones 3G8, FUN-2 and 10.1 respectively?: Yes

Other Formats

View All CD16 Reagents Request Custom Conjugation

Description	Clone	Applications
APC anti-human CD16	3G8	FC
Biotin anti-human CD16	3G8	FC
FITC anti-human CD16	3G8	FC
Brilliant Violet 711™ anti-human CD16	3G8	FC
PE anti-human CD16	3G8	FC
PE/Cyanine5 anti-human CD16	3G8	FC
Purified anti-human CD16	3G8	FC,CyTOF®,Block,IHC-F,IP,Stim
APC/Cyanine7 anti-human CD16	3G8	FC
PE/Cyanine7 anti-human CD16	3G8	FC
Alexa Fluor® 488 anti-human CD16	3G8	FC
Alexa Fluor® 647 anti-human CD16	3G8	FC
Pacific Blue™ anti-human CD16	3G8	FC
Alexa Fluor® 700 anti-human CD16	3G8	FC
PerCP/Cyanine5.5 anti-human CD16	3G8	FC
PerCP anti-human CD16	3G8	FC
Brilliant Violet 421™ anti-human CD16	3G8	FC
Brilliant Violet 570™ anti-human CD16	3G8	FC
Brilliant Violet 605™ anti-human CD16	3G8	FC
Brilliant Violet 650™ anti-human CD16	3G8	FC
Brilliant Violet 785™ anti-human CD16	3G8	FC
Brilliant Violet 510™ anti-human CD16	3G8	FC
Ultra-LEAF™ Purified anti-human CD16	3G8	FC,CyTOF®,Block,IHC-F,IP,Stim
Purified anti-human CD16 (Maxpar® Ready)	3G8	FC,CyTOF®
PE/Dazzle™ 594 anti-human CD16	3G8	FC
APC/Fire™ 750 anti-human CD16	3G8	FC
PE anti-human CD16	3G8	FC
APC anti-human CD16	3G8	FC
Pacific Blue™ anti-human CD16	3G8	FC
PE/Dazzle™ 594 anti-human CD16	3G8	FC
TotalSeq™-A0083 anti-human CD16	3G8	PG
TotalSeq™-B0083 anti-human CD16	3G8	PG
TotalSeq™-C0083 anti-human CD16	3G8	PG
PE/Cyanine7 anti-human CD16	3G8	FC
PE/Fire™ 640 anti-human CD16	3G8	FC
FITC anti-human CD16	3G8	FC
Spark YG™ 581 anti-human CD16	3G8	FC
APC/Fire™ 750 anti-human CD16	3G8	FC
TotalSeq™-D0083 anti-human CD16	3G8	PG
APC/Fire™ 810 anti-human CD16	3G8	FC
GMP APC anti-human CD16	3G8	FC
GMP PE/Dazzle™ 594 anti-human CD16	3G8	FC
GMP PE anti-human CD16	3G8	FC
Spark Red™ 718 anti-human CD16	3G8	FC
GMP Pacific Blue™ anti-human CD16	3G8	FC
GMP FITC anti-human CD16	3G8	FC
Spark Blue™ 515 anti-human CD16	3G8	FC
Spark UV™ 387 anti-human CD16	3G8	FC
PerCP/Cyanine5.5 anti-human CD16	3G8	FC
GMP PE/Cyanine7 anti-human CD16	3G8	FC
GMP APC/Fire™ 750 anti-human CD16	3G8	FC
Brilliant Violet 750™ anti-human CD16	3G8	FC
Spark Blue™ 550 anti-human CD16	3G8	FC
GMP PerCP/Cyanine5.5 anti-human CD16	3G8	FC
Spark YG™ 593 anti-human CD16	3G8	FC
Spark NIR™ 685 anti-human CD16	3G8	FC
Spark Violet™ 500 anti-human CD16	3G8	FC
Spark Blue™ 574 anti-human CD16 (Flexi-Fluor™)	3G8	FC
Spark PLUS UV395™ anti-human CD16	3G8	FC

Certificate of Analysis

Go To Top Version: 1 Revision Date: 05.24.2021

For Research Use Only. Not for diagnostic or therapeutic use.

This product is supplied subject to the terms and conditions, including the limited license, located at www.biolegend.com/terms) ("Terms") and may be used only as provided in the Terms. Without limiting the foregoing, BioLegend products may not be used for any Commercial Purpose as defined in the Terms, resold in any form, used in manufacturing, or reverse engineered, sequenced, or otherwise studied or used to learn its design or composition without express written approval of BioLegend. Regardless of the information given in this document, user is solely responsible for determining any license requirements necessary for user’s intended use and assumes all risk and liability arising from use of the product. BioLegend is not responsible for patent infringement or any other risks or liabilities whatsoever resulting from the use of its products.

BioLegend, the BioLegend logo, and all other trademarks are property of BioLegend, Inc. or their respective owners, and all rights are reserved.

8999 BioLegend Way, San Diego, CA 92121 www.biolegend.com
Toll-Free Phone: 1-877-Bio-Legend (246-5343) Phone: (858) 768-5800 Fax: (877) 455-9587

This data display is provided for general comparisons between formats.
Your actual data may vary due to variations in samples, target cells, instruments and their settings, staining conditions, and other factors.
If you need assistance with selecting the best format contact our expert technical support team.