- Clone
- 3G8 (See other available formats)
- Regulatory Status
- RUO
- Workshop
- V NK80
- Other Names
- FcγRIII, Fc gamma receptor, Fc gamma receptor 3
- Isotype
- Mouse IgG1, κ
- Barcode Sequence
- AAGTTCACTCTTTGC
- Ave. Rating
- Submit a Review
- Product Citations
- publications
Cat # | Size | Price | Quantity Check Availability | Save | ||
---|---|---|---|---|---|---|
302071 | 10 µg | 369 CHF |
CD16 is known as low affinity IgG receptor III (FcγRIII). It is expressed as two distinct forms (CD16a and CD16b). CD16a (FcγRIIIA) is a 50-65 kD polypeptide-anchored transmembrane protein. It is expressed on the surface of NK cells, activated monocytes, macrophages, and placental trophoblasts in humans. CD16b (FcγRIIIB) is a 48 kD glycosylphosphatidylinositol (GPI)-anchored protein. Its extracellular domain is over 95% homologous to that of CD16a, and it is expressed specifically on neutrophils. CD16 binds aggregated IgG or IgG-antigen complex which functions in NK cell activation, phagocytosis, and antibody-dependent cell-mediated cytotoxicity (ADCC).
Product DetailsProduct Details
- Verified Reactivity
- Human, Cynomolgus, Rhesus
- Reported Reactivity
- African Green, Baboon, Capuchin Monkey, Chimpanzee, Common Marmoset, Pigtailed Macaque, Sooty Mangabey, Squirrel Monkey
- Antibody Type
- Monoclonal
- Host Species
- Mouse
- Immunogen
- Human PMN cells
- Formulation
- Phosphate-buffered solution, pH 7.2, containing 0.09% sodium azide and EDTA
- Preparation
- The antibody was purified by chromatography and conjugated with TotalSeq™-D oligomer under optimal conditions.
- Concentration
- 0.5 mg/mL
- Storage & Handling
- The antibody solution should be stored undiluted between 2°C and 8°C. Do not freeze.
- Application
-
PG - Quality tested
- Recommended Usage
-
Each lot of this antibody is quality control tested by immunofluorescent staining with flow cytometric analysis and the oligomer sequence is confirmed by sequencing. TotalSeq™-D antibodies are compatible with Mission Bio’s Tapestri Single-Cell Sequencing Platform for simultaneous detection of DNA and Protein.
To maximize performance, it is strongly recommended that the reagent be titrated for each application, and that you centrifuge the antibody dilution before adding to the cells at 14,000xg at 2 - 8°C for 10 minutes. Carefully pipette out the liquid avoiding the bottom of the tube and add to the cell suspension. For Proteogenomics analysis, the suggested starting amount of this reagent for titration is ≤ 1.0 µg per million cells in 100 µL volume. Refer to the corresponding TotalSeq™ protocol for specific staining instructions.
Buyer is solely responsible for determining whether Buyer has all intellectual property rights that are necessary for Buyer's intended uses of the BioLegend TotalSeq™ products. For example, for any technology platform Buyer uses with TotalSeq™, it is Buyer's sole responsibility to determine whether it has all necessary third party intellectual property rights to use that platform and TotalSeq™ with that platform. - Application Notes
-
The 3G8 antibody clone blocks neutrophil phagocytosis and stimulates NK cell proliferation. It has been reported that this clone interacts with the FcγRIIa and FcγRIIIb receptors causing neutrophil activation and aggregation18. Due to this phenomenon staining in whole blood may cause a reduction in the number of granulocytes or alter their scatter profile.
Additional reported applications (for the relevant formats) include: immunohistochemical staining of acetone-fixed frozen tissue sections6, immunoprecipitation3, stimulation of NK cell proliferation4, blocking of phagocytosis5, and blocking of immunoglobulin binding to FcγRIII7,8. The Ultra-LEAF™ purified antibody (Endotoxin < 0.01 EU/µg, Azide-Free, 0.2 µm filtered) is recommended for functional assays (Cat. No. 302049, 302050, 302057, 302058). - Additional Product Notes
-
TotalSeq™-D reagents are designed to profile protein expression at single cell level. The Mission Bio Tapestri platform and sequencer (e.g. Illumina analyzers) are required. Please contact technical support for more information, or visit biolegend.com/totalseq/single-cell-dna
The barcode flanking sequences are CGAGATGACTACGCTACTCATGG (PCR handle), and GAGCCGATCTAGTATCTCAGT*C*G (capture sequence). * indicates a phosphorothioated bond, to prevent nuclease degradation.
View more applications data for this product in our Application Technical Notes. -
Application References
(PubMed link indicates BioLegend citation) -
- Knapp W, et al. Eds. 1989. Leucocyte Typing IV. Oxford University Press. New York.
- Schlossman S, et al. Eds. 1995. Leucocyte Typing V. Oxford University Press. New York.
- Edberg J, et al. 1997. J. Immunol. 159:3849. (IP)
- Hoshino S, et al. 1991. Blood 78:3232. (Stim)
- Tamm A, et al. 1996. Immunol. 157:1576. (Block)
- Da Silva DM, et al. 2001. Int. Immunol. 13:633. (IHC)
- Holl V, et al. 2004. J. Immunol. 173:6274. (Block)
- Hober D, et al. 2002. J. Gen. Virol. 83:2169. (Block)
- Brainard DM, et al. 2009. J. Virol. 83:7305. PubMed
- Smed-Sörensen A, et al. 2008. Blood 111:5037. (Block) PubMed
- Timmerman KL, et al. 2008. J. Leukoc. Biol. 84:1271. (FC) PubMed
- Yoshino N, et al. 2000. Exp. Anim. (Tokyo) 49:97. (FC)
- Rout N, et al. 2010. PLoS One 5:e9787. (FC)
- Kim WK, et al. 2006. Am. J. Pathol. 168:822. (FC)
- Boltz A, et al. 2011. J. Biol Chem. 286:21896. PubMed
- Wu Z, et al. 2013. J. Virol. 87:7717. PubMed
- Peterson VM, et al. 2017. Nat. Biotechnol. 35:936. (PG)
- Vossebeld PJ, et al. 1997. Biochem J. 323:87-94 (Stim)
- RRID
-
AB_2892348 (BioLegend Cat. No. 302071)
Antigen Details
- Structure
- Ig superfamily, transmembrane form (50-65 kD) or GPI-linked form (48 kD)
- Distribution
-
NK cells, activated monocytes, macrophages, neutrophils
- Function
- Low affinity IgG Fc receptor, phagocytosis, ADCC
- Ligand/Receptor
- Aggregated IgG, IgG-antigen complex
- Cell Type
- Dendritic cells, Macrophages, Monocytes, Neutrophils, NK cells
- Biology Area
- Immunology, Innate Immunity
- Molecular Family
- CD Molecules, Fc Receptors
- Antigen References
-
1. Fleit H, et al. 1982. P. Natl. Acad. Sci. USA 79:3275.
2. Stroncek D, et al. 1991. Blood 77:1572.
3. Wirthmueller U, et al. 1992. J. Exp. Med. 175:1381. - Gene ID
- 2214 View all products for this Gene ID
- UniProt
- View information about CD16 on UniProt.org
Related FAQs
- Is our human Trustain FcX™ (cat# 422302) compatible with anti human CD16, CD32 and CD64 clones 3G8, FUN-2 and 10.1 respectively?
-
Yes
Other Formats
View All CD16 Reagents Request Custom ConjugationCompare Data Across All Formats
This data display is provided for general comparisons between formats.
Your actual data may vary due to variations in samples, target cells, instruments and their settings, staining conditions, and other factors.
If you need assistance with selecting the best format contact our expert technical support team.
-
APC anti-human CD16
Human peripheral blood lymphocytes stained with 3G8 APC -
Biotin anti-human CD16
Human peripheral blood lymphocytes stained with biotinylated... -
FITC anti-human CD16
Human peripheral blood lymphocytes stained with 3G8 FITC -
Brilliant Violet 711™ anti-human CD16
Human peripheral blood lymphocytes were stained with CD16 (c... -
PE anti-human CD16
Human peripheral blood lymphocytes stained with 3G8 PE Human peripheral blood was stained with CD16 (clone 3G8) PE ... -
PE/Cyanine5 anti-human CD16
Human peripheral blood lymphocytes stained with 3G8 PE/Cyani... -
Purified anti-human CD16
Human peripheral blood lymphocytes stained with purified 3G8... -
APC/Cyanine7 anti-human CD16
Human peripheral blood lymphocytes stained with CD56 (NCAM) ... -
PE/Cyanine7 anti-human CD16
Human peripheral blood lymphocytes stained with 3G8 PE/Cyani... -
Alexa Fluor® 488 anti-human CD16
Human peripheral blood lymphocytes stained with 3G8 Alexa Fl... -
Alexa Fluor® 647 anti-human CD16
Human peripheral blood lymphocytes stained with 3G8 Alexa Fl... -
Pacific Blue™ anti-human CD16
Human peripheral blood lymphocytes stained with 3G8 Pacific ... -
Alexa Fluor® 700 anti-human CD16
Human peripheral blood lymphocytes stained with 3G8 Alexa fl... -
PerCP/Cyanine5.5 anti-human CD16
Human peripheral blood lymphocytes were stained with CD56 AP... -
PerCP anti-human CD16
Human peripheral blood lymphocytes stained with 3G8 PerCP -
Brilliant Violet 421™ anti-human CD16
Human peripheral blood lymphocytes were stained with CD16 (c... -
Brilliant Violet 570™ anti-human CD16
Human peripheral blood lymphocytes were stained with CD16 (c... -
Brilliant Violet 605™ anti-human CD16
Human peripheral blood lymphocytes were stained with CD16 (c... -
Brilliant Violet 650™ anti-human CD16
Human peripheral blood lymphocytes were stained with CD16 (c... -
Brilliant Violet 785™ anti-human CD16
Human peripheral blood lymphocytes were stained with CD56 AP... -
Brilliant Violet 510™ anti-human CD16
Human peripheral blood lymphocytes were stained with CD16 (c... -
Ultra-LEAF™ Purified anti-human CD16
Human peripheral blood lymphocytes stained with Ultra-LEAF™ ... -
Purified anti-human CD16 (Maxpar® Ready)
Human PBMCs stained with 152Sm-anti-CD13 (WM15) and 148Nd-an... -
PE/Dazzle™ 594 anti-human CD16
Human peripheral blood lymphocytes were stained with CD16 (c... -
APC/Fire™ 750 anti-human CD16
Human peripheral blood lymphocytes were stained with CD56 FI... -
PE anti-human CD16
Typical results from human peripheral blood lymphocytes stai... -
APC anti-human CD16
Typical results from human peripheral blood lymphocytes stai... -
Pacific Blue™ anti-human CD16
Typical results from human peripheral blood lymphocytes sta... -
PE/Dazzle™ 594 anti-human CD16
Typical results from human peripheral blood lymphocytes stai... -
TotalSeq™-A0083 anti-human CD16
-
TotalSeq™-B0083 anti-human CD16
-
TotalSeq™-C0083 anti-human CD16
-
PE/Cyanine7 anti-human CD16
Typical results from human peripheral blood lymphocytes stai... -
PE/Fire™ 640 anti-human CD16
Human peripheral blood lymphocytes were stained with CD56 (N... -
FITC anti-human CD16
Typical results from human peripheral blood lymphocytes stai... -
Spark YG™ 581 anti-human CD16
Human peripheral blood lymphocytes were stained with anti-hu... -
APC/Fire™ 750 anti-human CD16
Typical results from human peripheral blood lymphocytes stai... -
TotalSeq™-D0083 anti-human CD16
-
APC/Fire™ 810 anti-human CD16
Human peripheral blood lymphocytes were stained with anti-hu... -
GMP APC anti-human CD16
Typical results from human peripheral blood lymphocytes stai... -
GMP PE/Dazzle™ 594 anti-human CD16
Typical results from human peripheral blood lymphocytes stai... -
GMP PE anti-human CD16
Typical results from human peripheral blood lymphocytes stai... -
Spark Red™ 718 anti-human CD16
Human peripheral blood lymphocytes were stained with anti-hu... -
GMP Pacific Blue™ anti-human CD16
Typical results from human peripheral blood lymphocytes stai... -
GMP FITC anti-human CD16
Typical results from human peripheral blood lymphocytes stai... -
Spark Blue™ 515 anti-human CD16
Human peripheral blood lymphocytes were stained with anti-hu... -
Spark UV™ 387 anti-human CD16
Human peripheral blood lymphocytes were stained with anti-hu... -
PerCP/Cyanine5.5 anti-human CD16
Typical results from human peripheral blood lymphocytes stai... -
GMP PE/Cyanine7 anti-human CD16
Typical results from human peripheral blood lymphocytes stai... -
GMP APC/Fire™ 750 anti-human CD16
Typical results from human peripheral blood lymphocytes stai... -
Brilliant Violet 750™ anti-human CD16
Human peripheral blood lymphocytes were stained with anti-hu... -
Spark Blue™ 550 anti-human CD16
Human peripheral blood lymphocytes were stained with anti-hu... -
GMP PerCP/Cyanine5.5 anti-human CD16
Typical results from human peripheral blood lymphocytes stai... -
Spark YG™ 593 anti-human CD16
Human peripheral blood lymphocytes were stained with anti-hu... -
Spark NIR™ 685 anti-human CD16
Human peripheral blood lymphocytes were stained with anti-hu... -
Spark Violet™ 500 anti-human CD16
Human peripheral blood lymphocytes were stained with anti-hu... -
Spark Blue™ 574 anti-human CD16 (Flexi-Fluor™)
-
Spark PLUS UV395™ anti-human CD16
Human peripheral blood lymphocytes were stained with anti-hu... -
PerCP/Fire™ 806 anti-human CD16
Human peripheral blood lymphocytes were stained with anti-hu... Human peripheral blood monocytes were stained with anti-huma...
Follow Us