- Clone
- H57-597 (See other available formats)
- Regulatory Status
- RUO
- Other Names
- TCR-β chain, TCR-β, β-TCR
- Isotype
- Armenian Hamster IgG
- Barcode Sequence
- TCCTATGGGACTCAG
- Ave. Rating
- Submit a Review
- Product Citations
- publications
Cat # | Size | Price | Quantity Check Availability | Save | ||
---|---|---|---|---|---|---|
109265 | 10 µg | 369 CHF |
T cell receptor (TCR) is a heterodimer consisting of an α and a β chain (TCR α/β) or a γ and a δ chain (TCR γ/δ). TCR-β is a member of the immunoglobulin superfamily and a component of the CD3/TCR complex (along with TCR-α). It is expressed on α/β TCR-bearing T cells and thymocytes. The CD3/TCR complex plays a key role in antigen recognition, signal transduction, and T cell activation.
Product DetailsProduct Details
- Verified Reactivity
- Mouse
- Antibody Type
- Monoclonal
- Host Species
- Armenian Hamster
- Immunogen
- Affinity purified TCR from mouse DO-11.10 cells
- Formulation
- Phosphate-buffered solution, pH 7.2, containing 0.09% sodium azide and EDTA
- Preparation
- The antibody was purified by chromatography and conjugated with TotalSeq™-D oligomer under optimal conditions.
- Concentration
- 0.5 mg/mL
- Storage & Handling
- The antibody solution should be stored undiluted between 2°C and 8°C. Do not freeze.
- Application
-
PG - Quality tested
- Recommended Usage
-
Each lot of this antibody is quality control tested by immunofluorescent staining with flow cytometric analysis and the oligomer sequence is confirmed by sequencing. TotalSeq™-D antibodies are compatible with Mission Bio’s Tapestri Single-Cell Sequencing Platform for simultaneous detection of DNA and Protein. To maximize performance, it is strongly recommended that the reagent be titrated for each application, and that you centrifuge the antibody dilution before adding to the cells at 14,000xg at 2 - 8°C for 10 minutes. Carefully pipette out the liquid avoiding the bottom of the tube and add to the cell suspension. For Proteogenomics analysis, the suggested starting amount of this reagent for titration is ≤ 1.0 µg per million cells in 100 µL volume. Refer to the corresponding TotalSeq™ protocol for specific staining instructions.
Buyer is solely responsible for determining whether Buyer has all intellectual property rights that are necessary for Buyer's intended uses of the BioLegend TotalSeq™ products. For example, for any technology platform Buyer uses with TotalSeq™, it is Buyer's sole responsibility to determine whether it has all necessary third party intellectual property rights to use that platform and TotalSeq™ with that platform. - Application Notes
-
H57-597 is a hamster mAb directed to an epitope of the C region of TCR ß chain12. The H57-597 antibody does not cross-react with ?/d TCR-bearing T cells. Immobilized or soluble H57-597 antibody can activate a/ß TCR-bearing T cells. Additional reported applications (for the relevant formats) for this antibody include: immunoprecipitation2, in vitro stimulation2,3, in vivo depletion4-6, and immunohistochemical staining of acetone-fixed frozen sections7,8,9. The Ultra-LEAF™ purified antibody (Endotoxin <0.01 EU/µg, Azide-Free, 0.2 µm filtered) is recommended for functional assays (Cat. No. 109253-109258).
- Additional Product Notes
-
TotalSeq™-D reagents are designed to profile protein expression at single cell level. The Mission Bio Tapestri platform and sequencer (e.g. Illumina analyzers) are required. Please contact technical support for more information, or visit biolegend.com/totalseq/single-cell-dna
The barcode flanking sequences are CGAGATGACTACGCTACTCATGG (PCR handle), and GAGCCGATCTAGTATCTCAGT*C*G (capture sequence). * indicates a phosphorothioated bond, to prevent nuclease degradation.
View more applications data for this product in our Application Technical Notes. -
Application References
(PubMed link indicates BioLegend citation) -
- Gascoigne NJ. 1990. J. Biol. Chem. 265:9296.
- Kruisbeek A, et al. 1991. In Current Protocols in Immunology. pp. 3.12.1. (Costim IP)
- Davenport C, et al. 1995. J. Immunol. 155:3742. (Costim)
- Drobyski W, et al. 1996. Blood 87:5355. (Deplete)
- Kummer U, et al. 2001. Immunol. Lett. 75:153. (Deplete)
- van der Heyde HC, et al. 1995. J. Immunol. 154:3985. (Deplete)
- Tomita K, et al. 1999. Genes Dev. 13:1203. (IHC)
- Podd BS, et al. 2006. J. Immunol. 176:6532. (IHC)
- Ponomarev ED, et al. 2007. J. Immunol. 178:39. (IHC)
- Chappaz S, et al. 2007. Blood doi:10.1182/blood-2007-02-074245. (FC) PubMed
- Tsukumo S, et al. 2006. J.Immunol. 177:8365. (FC) PubMed
- Grégoire C, et al. 1991. Proc. Natl. Acad. Sci USA 88:8077.
Antigen Details
- Structure
- Ig superfamily, CD3/TCR complex with CD3 and TCR α subunit
- Distribution
-
Majority of T cells and thymocytes (correlated to differentiation)
- Function
- Antigen recognition, T cell activation
- Ligand/Receptor
- Peptide bound-MHC class I and II
- Antigen References
-
1. Davis MM, et al. 1998. Ann. Rev. Immunol. 16:523.
2. Huppa JB, et al. 2003. Nat. Immunol. 4:749.
3. Kubo R, et al. 1989. J. Immunol. 142:2736. - Gene ID
- 21577 View all products for this Gene ID
- UniProt
- View information about TCR beta chain on UniProt.org
Related Pages & Pathways
Pages
Other Formats
View All TCR β chain Reagents Request Custom ConjugationCompare Data Across All Formats
This data display is provided for general comparisons between formats.
Your actual data may vary due to variations in samples, target cells, instruments and their settings, staining conditions, and other factors.
If you need assistance with selecting the best format contact our expert technical support team.
-
APC anti-mouse TCR β chain
-
Biotin anti-mouse TCR β chain
-
FITC anti-mouse TCR β chain
-
PE anti-mouse TCR β chain
-
PE/Cyanine5 anti-mouse TCR β chain
-
Purified anti-mouse TCR β chain
-
Alexa Fluor® 488 anti-mouse TCR β chain
-
Alexa Fluor® 647 anti-mouse TCR β chain
-
APC/Cyanine7 anti-mouse TCR β chain
-
PE/Cyanine7 anti-mouse TCR β chain
-
Alexa Fluor® 700 anti-mouse TCR β chain
-
Pacific Blue™ anti-mouse TCR β chain
-
Brilliant Violet 421™ anti-mouse TCR β chain
-
PerCP/Cyanine5.5 anti-mouse TCR β chain
-
Brilliant Violet 570™ anti-mouse TCR β chain
-
Brilliant Violet 510™ anti-mouse TCR β chain
-
Purified anti-mouse TCR β chain (Maxpar® Ready)
-
Alexa Fluor® 594 anti-mouse TCR β chain
-
PE/Dazzle™ 594 anti-mouse TCR β chain
-
Brilliant Violet 605™ anti-mouse TCR β chain
-
Brilliant Violet 711™ anti-mouse TCR β chain
-
APC/Fire™ 750 anti-mouse TCR β chain
-
TotalSeq™-A0120 anti-mouse TCR β chain
-
Brilliant Violet 785™ anti-mouse TCR β chain
-
Brilliant Violet 650™ anti-mouse TCR β chain
-
Ultra-LEAF™ Purified anti-mouse TCR β chain
-
TotalSeq™-C0120 anti-mouse TCR β chain
-
TotalSeq™-B0120 anti-mouse TCR β chain
-
Spark Red™ 718 anti-mouse TCR β chain (Flexi-Fluor™)
-
Spark PLUS UV395™ anti-mouse TCR β chain
-
TotalSeq™-D0120 anti-mouse TCR β chain
-
Spark Blue™ 574 anti-mouse TCR β chain (Flexi-Fluor™)
-
Spark Blue™ 550 anti-mouse TCR β chain (Flexi-Fluor™)
Follow Us