TotalSeq™-D0145 anti-human CD103 (Integrin αE) Antibody

Pricing & Availability
Clone
Ber-ACT8 (See other available formats)
Regulatory Status
RUO
Workshop
V A067
Other Names
Integrin alpha E (ITGAE)
Isotype
Mouse IgG1, κ
Barcode Sequence
GACCTCATTGTGAAT
Ave. Rating
Submit a Review
Product Citations
publications
Cat # Size Price Quantity Check Availability Save
350241 10 µg 369 CHF
Check Availability


Need larger quantities of this item?
Request Bulk Quote
Description

CD103 is a type I transmembrane glycoprotein also known as αE integrin, integrin αIEL chain, and human mucosal lymphocyte antigen 1. It belongs to the integrin family and is primarily found on intestinal intraepithelial lymphocytes (IEL). CD103 is also expressed on a subpopulation of lamina propria T cells, epithelial dendritic cells, lamina propria-derived dendritic cells, and a small subset of peripheral lymphocytes. Treg cells express high level of CD103. Hairy cell leukemia has also been shown to express CD103. The expression of CD103 on lymphocytes can be induced upon activation and TGF-β stimulation. In association with integrin β7, CD103 is expressed as an αE/β7 heterodimer. Mature CD103 protein can be cleaved into 2 chains, a 150 kD (C-terminal) chain and a 25 kD (N-terminal) chain, which remain linked by disulfide bonds. CD103 binds to E-cadherin and mediates homing of lymphocytes to the intestinal epithelium.

Product Details
Technical Data Sheet (pdf)

Product Details

Verified Reactivity
Human
Reported Reactivity
Cynomolgus
Antibody Type
Monoclonal
Host Species
Mouse
Immunogen
HTLV-1 induced human T cell line MAPS16
Formulation
Phosphate-buffered solution, pH 7.2, containing 0.09% sodium azide and EDTA
Preparation
The antibody was purified by chromatography and conjugated with TotalSeq™-D oligomer under optimal conditions.
Concentration
0.5 mg/mL
Storage & Handling
The antibody solution should be stored undiluted between 2°C and 8°C. Do not freeze.
Application

PG - Quality tested

Recommended Usage

Each lot of this antibody is quality control tested by immunofluorescent staining with flow cytometric analysis and the oligomer sequence is confirmed by sequencing. TotalSeq™-D antibodies are compatible with Mission Bio’s Tapestri Single-Cell Sequencing Platform for simultaneous detection of DNA and Protein.

 

To maximize performance, it is strongly recommended that the reagent be titrated for each application, and that you centrifuge the antibody dilution before adding to the cells at 14,000xg at 2 - 8°C for 10 minutes. Carefully pipette out the liquid avoiding the bottom of the tube and add to the cell suspension. For Proteogenomics analysis, the suggested starting amount of this reagent for titration is ≤ 1.0 µg per million cells in 100 µL volume. Refer to the corresponding TotalSeq™ protocol for specific staining instructions.


Buyer is solely responsible for determining whether Buyer has all intellectual property rights that are necessary for Buyer's intended uses of the BioLegend TotalSeq™ products. For example, for any technology platform Buyer uses with TotalSeq™, it is Buyer's sole responsibility to determine whether it has all necessary third party intellectual property rights to use that platform and TotalSeq™ with that platform.
Application Notes

Additional reported applications (for the relevant formats) include: Western Blotting1, immunoprecipitation1, and immunohistochemical staining of frozen tissue sections1.

Additional Product Notes

TotalSeq™-D reagents are designed to profile protein expression at single cell level. The Mission Bio Tapestri platform and sequencer (e.g. Illumina analyzers) are required. Please contact technical support for more information, or visit biolegend.com/totalseq/single-cell-dna

The barcode flanking sequences are CGAGATGACTACGCTACTCATGG (PCR handle), and GAGCCGATCTAGTATCTCAGT*C*G (capture sequence). * indicates a phosphorothioated bond, to prevent nuclease degradation.

View more applications data for this product in our Application Technical Notes.

Application References

(PubMed link indicates BioLegend citation)
  1. Kruschwitz M, et al. 1991. J. Clin. Pathol. 44:636. (WB, IP, IHC-F)
  2. Yoshino N, et al. 2000. Exp. Anim. (Tokyo) 49:97. (FC)
RRID
AB_2922567 (BioLegend Cat. No. 350241)

Antigen Details

Structure
Type I transmembrane glycoprotein, integrin family; can be cleaved into 150 kD and 25 kD chains; associated with β7 integrin
Distribution

Majority of intestinal intraepithelial lymphocytes (IEL), subpopulation of lamina propria T cells, epithelial dendritic cells, small subset of peripheral lymphocytes, Treg cells; expressed on hairy cell leukemia

Function
Retention and activation of CD103+ lymphocytes in the intestinal epithelium, regulation of tissue-specific T cell homing
Ligand/Receptor
E-Cadherin
Cell Targets
Integrin β7
Cell Type
Dendritic cells, Lymphocytes, T cells, Tregs
Biology Area
Cell Biology, Immunology, Neuroscience, Synaptic Biology
Molecular Family
Adhesion Molecules, CD Molecules
Antigen References

1. Parker CM, et al. 1992. P. Natl. Acad. Sci. USA 89:1924.
2. Kruschwitz M, et al. 1991. J. Clin. Pathol. 44:636.
3. Schon MP, et al. 1999. J. Immunol. 162:6641.
4. Shaw SK, et al. 1994. J. Biol. Chem. 269:6016.

Gene ID
3682 View all products for this Gene ID
UniProt
View information about CD103 on UniProt.org

Related FAQs

There are no FAQs for this product.

Other Formats

View All CD103 Reagents Request Custom Conjugation
Description Clone Applications
Purified anti-human CD103 (Integrin αE) Ber-ACT8 FC,WB,IP,IHC-F
FITC anti-human CD103 (Integrin αE) Ber-ACT8 FC
PE anti-human CD103 (Integrin αE) Ber-ACT8 FC
Alexa Fluor® 488 anti-human CD103 (Integrin αE) Ber-ACT8 FC
Alexa Fluor® 647 anti-human CD103 (Integrin αE) Ber-ACT8 FC
PE/Cyanine7 anti-human CD103 (Integrin αE) Ber-ACT8 FC
Brilliant Violet 421™ anti-human CD103 (Integrin αE) Ber-ACT8 FC
APC anti-human CD103 (Integrin αE) Ber-ACT8 FC
Brilliant Violet 605™ anti-human CD103 (Integrin αE) Ber-ACT8 FC
Biotin anti-human CD103 (Integrin αE) Ber-ACT8 FC
Brilliant Violet 711™ anti-human CD103 (Integrin αE) Ber-ACT8 FC
PE/Dazzle™ 594 anti-human CD103 (Integrin αE) Ber-ACT8 FC
PerCP/Cyanine5.5 anti-human CD103 (Integrin αE) Ber-ACT8 FC
Brilliant Violet 785™ anti-human CD103 (Integrin αE) Ber-ACT8 FC
APC/Cyanine7 anti-human CD103 (Integrin αE) Ber-ACT8 FC
TotalSeq™-A0145 anti-human CD103 (Integrin αE) Ber-ACT8 PG
TotalSeq™-C0145 anti-human CD103 (Integrin αE) Ber-ACT8 PG
TotalSeq™-B0145 anti-human CD103 (Integrin αE) Ber-ACT8 PG
APC/Fire™ 750 anti-human CD103 (Integrin αE) Ber-ACT8 FC
PE/Fire™ 700 anti-human CD103 (Integrin αE) Antibody Ber-ACT8 FC
TotalSeq™-D0145 anti-human CD103 (Integrin αE) Ber-ACT8 PG
PE/Fire™ 640 anti-human CD103 (Integrin αE) Ber-ACT8 FC
PE anti-human CD103 Ber-ACT8 FC
FITC anti-human CD103 Ber-ACT8 FC
APC anti-human CD103 Ber-ACT8 FC
Spark YG™ 581 anti-human CD103 (Integrin αE) Ber-ACT8 FC
Spark NIR™ 685 anti-human CD103 (Integrin αE) Ber-ACT8 FC
Spark Blue™ 550 anti-human CD103 (Integrin αE) Ber-ACT8 FC
PE/Fire™ 810 anti-human CD103 (Integrin αE) Ber-ACT8 FC
GMP FITC anti-human CD103 (Integrin αE) Ber-ACT8 FC
GMP PE anti-human CD103 (Integrin αE) Ber-ACT8 FC
Spark Red™ 718 anti-human CD103 (Integrin αE) (Flexi-Fluor™) Ber-ACT8 FC
Spark Blue™ 574 anti-human CD103 (Integrin αE) (Flexi-Fluor™) Ber-ACT8 FC
Go To Top Version: 1    Revision Date: 03.22.2022

For Research Use Only. Not for diagnostic or therapeutic use.

 

This product is supplied subject to the terms and conditions, including the limited license, located at www.biolegend.com/terms) ("Terms") and may be used only as provided in the Terms. Without limiting the foregoing, BioLegend products may not be used for any Commercial Purpose as defined in the Terms, resold in any form, used in manufacturing, or reverse engineered, sequenced, or otherwise studied or used to learn its design or composition without express written approval of BioLegend. Regardless of the information given in this document, user is solely responsible for determining any license requirements necessary for user’s intended use and assumes all risk and liability arising from use of the product. BioLegend is not responsible for patent infringement or any other risks or liabilities whatsoever resulting from the use of its products.

 

BioLegend, the BioLegend logo, and all other trademarks are property of BioLegend, Inc. or their respective owners, and all rights are reserved.

 

8999 BioLegend Way, San Diego, CA 92121 www.biolegend.com
Toll-Free Phone: 1-877-Bio-Legend (246-5343) Phone: (858) 768-5800 Fax: (877) 455-9587

This data display is provided for general comparisons between formats.
Your actual data may vary due to variations in samples, target cells, instruments and their settings, staining conditions, and other factors.
If you need assistance with selecting the best format contact our expert technical support team.

ProductsHere

Login / Register
Remember me
Forgot your password? Reset password?
Create an Account