IMPORTANT NOTICE: Our email addresses will soon change. Learn more >>

TotalSeq™-D0369 anti-human CD29 Antibody

Pricing & Availability
Clone
TS2/16 (See other available formats)
Regulatory Status
RUO
Workshop
V A-S202
Other Names
Integrin β1 chain, VLA-β chain, gpIIa, ITGB1
Isotype
Mouse IgG1, κ
Barcode Sequence
GTATTCCCTCAGTCA
Ave. Rating
Submit a Review
Cat # Size Price Quantity Check Availability Save
303037 10 µg 369 CHF
Check Availability


Need larger quantities of this item?
Request Bulk Quote
Description

CD29 is a 130 kD single chain type I glycoprotein also known as integrin β1, VLA-β chain, or gpIIa. It is broadly expressed on a majority of hematopoietic and non-hematopoietic cells, including leukocytes (although at low level on granulocytes), platelets, fibroblasts, endothelial cells, epithelial cells, and mast cells. CD29 is a member of the integrin family. It is non-covalently associated with integrin α1-α6 chains to form VLA-1 to VLA-6 molecules, respectively. Integrins, which include CD29, bind to several cell surface (e.g. VCAM-1, MadCAM-1) and extracellular matrix molecules. CD29 acts as a fibronectin receptor and is involved in a variety of cell-cell and cell-matrix interactions.

Product Details
Technical Data Sheet (pdf)

Product Details

Verified Reactivity
Human
Reported Reactivity
African Green, Baboon, Cow, Cynomolgus, Dog, Horse, Rhesus
Antibody Type
Monoclonal
Host Species
Mouse
Formulation
Phosphate-buffered solution, pH 7.2, containing 0.09% sodium azide and EDTA
Preparation
The antibody was purified by chromatography and conjugated with TotalSeq™-D oligomer under optimal conditions.
Concentration
0.5 mg/mL
Storage & Handling
The antibody solution should be stored undiluted between 2°C and 8°C. Do not freeze.
Application

PG - Quality tested

Recommended Usage

Each lot of this antibody is quality control tested by immunofluorescent staining with flow cytometric analysis and the oligomer sequence is confirmed by sequencing. TotalSeq™-D antibodies are compatible with Mission Bio’s Tapestri Single-Cell Sequencing Platform for simultaneous detection of DNA and Protein.

To maximize performance, it is strongly recommended that the reagent be titrated for each application, and that you centrifuge the antibody dilution before adding to the cells at 14,000xg at 2 - 8°C for 10 minutes. Carefully pipette out the liquid avoiding the bottom of the tube and add to the cell suspension. For Proteogenomics analysis, the suggested starting amount of this reagent for titration is ≤ 1.0 µg per million cells in 100 µL volume. Refer to the corresponding TotalSeq™ protocol for specific staining instructions.


Buyer is solely responsible for determining whether Buyer has all intellectual property rights that are necessary for Buyer's intended uses of the BioLegend TotalSeq™ products. For example, for any technology platform Buyer uses with TotalSeq™, it is Buyer's sole responsibility to determine whether it has all necessary third party intellectual property rights to use that platform and TotalSeq™ with that platform.
Application Notes

Additional reported applications (for the relevant formats) include: immunoprecipitation3, immunohistochemical staining of acetone-fixed frozen tissue sections3,5, and activation of integrin ß14,7,8. The LEAF™ purified antibody (Endotoxin <0.1 EU/µg, Azide-Free, 0.2 µm filtered) is recommended for functional assays (Cat. No. 303010). Clone TS2/16 recognizes epitope A2.10

Additional Product Notes

TotalSeq™-D reagents are designed to profile protein expression at single cell level. The Mission Bio Tapestri platform and sequencer (e.g. Illumina analyzers) are required. Please contact technical support for more information, or visit biolegend.com/totalseq/single-cell-dna

The barcode flanking sequences are CGAGATGACTACGCTACTCATGG (PCR handle), and GAGCCGATCTAGTATCTCAGT*C*G (capture sequence). * indicates a phosphorothioated bond, to prevent nuclease degradation.

View more applications data for this product in our Application Technical Notes.

Application References

(PubMed link indicates BioLegend citation)
  1. Schlossman S, et al. Eds. 1995. Leucocyte Typing V. Oxford University Press. New York.
  2. Gutierrez-Lopez M, et al. 2003. J. Biol. Chem. 278:208.
  3. Hemler ME, et al. 1984. J. Immunol. 132:3011. (IHC, IP)
  4. Sanchez-Aparicio P, et al. 1994. J. Cell Biol. 126:271. (Activ)
  5. Frank NY, et al. 2005. Cancer Res. 65:4320. (IHC)
  6. Murga M, et al. 2005. Blood 105:1992. (FC) PubMed
  7. Porter JC and Hogg N. 1997. J. Cell Biol. 138:1437. (Activ)
  8. Conway RE, et al. 2006. Mol. Cell. Biol. 26:5310. (Activ)
  9. Wesseling J, et al. 1995. J. Cell. Biol. 129:255. (Dog Reactivity)
  10. Rubio G, et al. 2002. Cancer Immunol. Immunother. 51:130.
  11. Dong A, et al. 2015. J Biol Chem. 290:8016. PubMed
  12. Paebst F, et al. 2014. Cytometry A. 85(8):678-87. (Horse reactivity)
RRID
AB_2941468 (BioLegend Cat. No. 303037)

Antigen Details

Structure
Integrin, type I glycoprotein, forms VLA-1 to VLA-6 heterodimers with CD49a-f (α16), also associates with CD51 (αV), and α7- α9, 130 kD
Distribution

Lymphocytes, monocytes, granulocytes (low), platelets, mast cells, fibroblasts, endothelial cells

Function
Cell-cell and cell-matrix interactions
Ligand/Receptor
VCAM-1, MAdCAM-1, ECM
Cell Type
Embryonic Stem Cells, Endothelial cells, Fibroblasts, Granulocytes, Lymphocytes, Mast cells, Mesenchymal Stem Cells, Monocytes, Platelets, Tregs
Biology Area
Cell Adhesion, Cell Biology, Immunology, Innate Immunity, Stem Cells
Molecular Family
Adhesion Molecules, CD Molecules
Antigen References

1. Hemler M. 1990. Annu. Rev. Immunol. 8:365.
2. Hynes R. 1992. Cell 69:11.

Gene ID
3688 View all products for this Gene ID
UniProt
View information about CD29 on UniProt.org

Related FAQs

There are no FAQs for this product.
Go To Top Version: 1    Revision Date: 05.17.2023

For Research Use Only. Not for diagnostic or therapeutic use.

 

This product is supplied subject to the terms and conditions, including the limited license, located at www.biolegend.com/terms) ("Terms") and may be used only as provided in the Terms. Without limiting the foregoing, BioLegend products may not be used for any Commercial Purpose as defined in the Terms, resold in any form, used in manufacturing, or reverse engineered, sequenced, or otherwise studied or used to learn its design or composition without express written approval of BioLegend. Regardless of the information given in this document, user is solely responsible for determining any license requirements necessary for user’s intended use and assumes all risk and liability arising from use of the product. BioLegend is not responsible for patent infringement or any other risks or liabilities whatsoever resulting from the use of its products.

 

BioLegend, the BioLegend logo, and all other trademarks are property of BioLegend, Inc. or their respective owners, and all rights are reserved.

 

8999 BioLegend Way, San Diego, CA 92121 www.biolegend.com
Toll-Free Phone: 1-877-Bio-Legend (246-5343) Phone: (858) 768-5800 Fax: (877) 455-9587

This data display is provided for general comparisons between formats.
Your actual data may vary due to variations in samples, target cells, instruments and their settings, staining conditions, and other factors.
If you need assistance with selecting the best format contact our expert technical support team.


Login / Register
Remember me
Forgot your password? Reset password?
Create an Account