- Clone
- DX9 (See other available formats)
- Regulatory Status
- RUO
- Other Names
- NKAT3, NKB1, KIR-NKB1, p70
- Isotype
- Mouse IgG1, κ
- Barcode Sequence
- GGACGCTTTCCTTGA
- Ave. Rating
- Submit a Review
- Product Citations
- publications
Cat # | Size | Price | Quantity Check Availability | Save | ||
---|---|---|---|---|---|---|
312735 | 10 µg | 369 CHF |
CD158e1, also known as NKB1, is a 70 kD member of the immunoglobulin superfamily that is expressed on a subset of natural killer cells and T cells at varying levels among individuals. NKB1 is a type I membrane protein containing two immunoglobulin C2-type domains. The interaction of NKB1 with specific HLA-B antigens on a target cell (the HLA-Bw4 allele, for example) inhibits cytotoxicity and prevents target cell lysis and death. The interactions between KIR and MHC class I are thought to be important in NK and T cell regulation following antigen stimulation. The absence of ligands for KIRs may lower the threshold for activation through activating receptors and increase inflammation and susceptibility to autoimmune disease.
Product DetailsProduct Details
- Verified Reactivity
- Human
- Antibody Type
- Monoclonal
- Host Species
- Mouse
- Immunogen
- Human NK cell clone VL186-1.6
- Formulation
- Phosphate-buffered solution, pH 7.2, containing 0.09% sodium azide and EDTA
- Preparation
- The antibody was purified by chromatography and conjugated with TotalSeq™-D oligomer under optimal conditions.
- Concentration
- 0.5 mg/mL
- Storage & Handling
- The antibody solution should be stored undiluted between 2°C and 8°C. Do not freeze.
- Application
-
PG - Quality tested
- Recommended Usage
-
Each lot of this antibody is quality control tested by immunofluorescent staining with flow cytometric analysis and the oligomer sequence is confirmed by sequencing. TotalSeq™-D antibodies are compatible with Mission Bio’s Tapestri Single-Cell Sequencing Platform for simultaneous detection of DNA and Protein.
To maximize performance, it is strongly recommended that the reagent be titrated for each application, and that you centrifuge the antibody dilution before adding to the cells at 14,000xg at 2 - 8°C for 10 minutes. Carefully pipette out the liquid avoiding the bottom of the tube and add to the cell suspension. For Proteogenomics analysis, the suggested starting amount of this reagent for titration is ≤ 1.0 µg per million cells in 100 µL volume. Refer to the corresponding TotalSeq™ protocol for specific staining instructions.
Buyer is solely responsible for determining whether Buyer has all intellectual property rights that are necessary for Buyer's intended uses of the BioLegend TotalSeq™ products. For example, for any technology platform Buyer uses with TotalSeq™, it is Buyer's sole responsibility to determine whether it has all necessary third party intellectual property rights to use that platform and TotalSeq™ with that platform. - Application Notes
-
The DX9 antibody reacts with the KIR (killer cell inhibitory receptor) designated NKB1 or KIR3DL1. Additional reported applications (for the relevant formats) include: immunoprecipitation1 and restoring the NK cell cytotoxicity4,8. The LEAF™ purified antibody (Endotoxin <0.1 EU/µg, Azide-Free, 0.2 µm filtered) is recommended for functional assays (Cat. No. 312710).
- Additional Product Notes
-
TotalSeq™-D reagents are designed to profile protein expression at single cell level. The Mission Bio Tapestri platform and sequencer (e.g. Illumina analyzers) are required. Please contact technical support for more information, or visit biolegend.com/totalseq/single-cell-dna
The barcode flanking sequences are CGAGATGACTACGCTACTCATGG (PCR handle), and GAGCCGATCTAGTATCTCAGT*C*G (capture sequence). * indicates a phosphorothioated bond, to prevent nuclease degradation.
View more applications data for this product in our Application Technical Notes. -
Application References
(PubMed link indicates BioLegend citation) -
- Litwin V, et al. 1994. J. Exp. Med. 180:537. (IP)
- Gumperz J, et al. 1996. J. Exp. Med. 183:1817.
- Gardiner CM, et al. 2001. J. Immunol. 166:2992.
- Bakker ABH, et al. 1998. J. Immunol. 160:5239.
- Goodier M, et al. 2000. J. Immunol. 165:139.
- Kirwan SE and Burshtyn DN. 2005. J. Immunol. 175:5006. (FC)
- Yawata M, et al. 2002. Immunogenetics 54:543.
- Valiante NM, et al. 1997. Immunity 7:739.
- Pascal V, et al. 2007. J. Immunol. 179:1625. (FC) PubMed
- Lichterfeld M, et al. 2008. J. Exp. Med. 204:2813. (FC) PubMed
- Luetke-Eversloh M, et al. 2014. PLoS Pathog. 10:1004441. PubMed
- Purdy AK, et al. 2014. J Immunol. 193:4675. PubMed
Antigen Details
- Structure
- Immunoglobulin superfamily member, contains two immunoglobulin C2-type domains, 70 kD type I membrane protein
- Distribution
-
Subset of NK and T cells
- Function
- Inhibits cytotoxic function of NK and T cells upon interacting with specific HLA-B antigens on target cell
- Ligand/Receptor
- HLA-B antigens such as the HLA-Bw4 allele
- Cell Type
- NK cells, T cells
- Biology Area
- Immunology
- Molecular Family
- CD Molecules
- Antigen References
-
1. Colonna M, et al. 1995. Science 268:405.
2. D'Andrea A, et al. 1995. J. Immunol.. 155:2306.
3. Uhrburg M, et al. 1997. Immunity 7:753.
4. Gumperz JE, et al. 1996. J. Exp. Med. 183:1817.
5. Wagtmann N, et al. 1995. Immunity 3:801. - Gene ID
- 3811 View all products for this Gene ID
- UniProt
- View information about CD158e1 on UniProt.org
Related Pages & Pathways
Pages
Related FAQs
Other Formats
View All CD158e1 Reagents Request Custom ConjugationCompare Data Across All Formats
This data display is provided for general comparisons between formats.
Your actual data may vary due to variations in samples, target cells, instruments and their settings, staining conditions, and other factors.
If you need assistance with selecting the best format contact our expert technical support team.
-
FITC anti-human CD158e1 (KIR3DL1, NKB1)
-
PE anti-human CD158e1 (KIR3DL1, NKB1)
-
Alexa Fluor® 700 anti-human CD158e1 (KIR3DL1, NKB1)
-
Brilliant Violet 421™ anti-human CD158e1 (KIR3DL1, NKB1)
-
PerCP/Cyanine5.5 anti-human CD158e1 (KIR3DL1, NKB1)
-
PE/Cyanine7 anti-human CD158e1 (KIR3DL1, NKB1)
-
APC anti-human CD158e1 (KIR3DL1, NKB1)
-
APC/Fire™ 750 anti-human CD158e1 (KIR3DL1, NKB1)
-
TotalSeq™-A0599 anti-human CD158e1 (KIR3DL1, NKB1)
-
TotalSeq™-C0599 anti-human CD158e1 (KIR3DL1, NKB1)
-
TotalSeq™-B0599 anti-human CD158e1 (KIR3DL1, NKB1)
-
Brilliant Violet 650™ anti-human CD158e1 (KIR3DL1, NKB1)
-
Brilliant Violet 711™ anti-human CD158e1 (KIR3DL1, NKB1)
-
Spark Red™ 718 anti-human CD158e1 (KIR3DL1, NKB1) (Flexi-Fluor™)
-
Brilliant Violet 605™ anti-human CD158e1 (KIR3DL1, NKB1)
-
TotalSeq™-D0559 anti-human CD158e1 (KIR3DL1, NKB1)
Follow Us