- Clone
- 9E9A8 (See other available formats)
- Regulatory Status
- RUO
- Other Names
- Dendritic Cell-Specific Intercellular adhesion molecule 3 (ICAM-3)-Grabbing Nonintegrin
- Isotype
- Mouse IgG2a, κ
- Barcode Sequence
- TCACTGGACACTTAA
- Ave. Rating
- Submit a Review
- Product Citations
- publications
Cat # | Size | Price | Quantity Check Availability | Save | ||
---|---|---|---|---|---|---|
330123 | 10 µg | 369 CHF |
CD209, known as Dendritic Cell-Specific Intercellular adhesion molecule 3 (ICAM-3)-Grabbing Nonintegrin (DC-SIGN), is a 44 kD type II transmembrane glycoprotein and a member of the C-type lectin family. CD209 is expressed on myeloid dendritic cells, placental macrophages, liver and placental endothelial cells. CD209 binds to ICAM-3 (CD50), ICAM-2 (CD102), and Butyrophilin (BTN2A1), and mediates dendritic cell migration and T cell proliferation. Importantly, CD209 is a receptor of HIV-1 and some other viruses (such as West Nile virus, hepatitis C virus, etc), and some bacteria or parasites. It plays a critical role in capturing and internalizing those pathogens. LSP1 (leukocyte-specific protein 1) interacts with the cytoplasmic domain of CD209 and mediates transport of HIV to the proteasome.
Product DetailsProduct Details
- Verified Reactivity
- Human
- Antibody Type
- Monoclonal
- Host Species
- Mouse
- Immunogen
- Extracellular domain of human DC-SIGN
- Formulation
- Phosphate-buffered solution, pH 7.2, containing 0.09% sodium azide and EDTA
- Preparation
- The antibody was purified by chromatography and conjugated with TotalSeq™-D oligomer under optimal conditions.
- Concentration
- 0.5 mg/mL
- Storage & Handling
- The antibody solution should be stored undiluted between 2°C and 8°C. Do not freeze.
- Application
-
PG - Quality tested
- Recommended Usage
-
Each lot of this antibody is quality control tested by immunofluorescent staining with flow cytometric analysis and the oligomer sequence is confirmed by sequencing. TotalSeq™-D antibodies are compatible with Mission Bio’s Tapestri Single-Cell Sequencing Platform for simultaneous detection of DNA and Protein.
To maximize performance, it is strongly recommended that the reagent be titrated for each application, and that you centrifuge the antibody dilution before adding to the cells at 14,000xg at 2 - 8°C for 10 minutes. Carefully pipette out the liquid avoiding the bottom of the tube and add to the cell suspension. For Proteogenomics analysis, the suggested starting amount of this reagent for titration is ≤ 1.0 µg per million cells in 100 µL volume. Refer to the corresponding TotalSeq™ protocol for specific staining instructions.
Buyer is solely responsible for determining whether Buyer has all intellectual property rights that are necessary for Buyer's intended uses of the BioLegend TotalSeq™ products. For example, for any technology platform Buyer uses with TotalSeq™, it is Buyer's sole responsibility to determine whether it has all necessary third party intellectual property rights to use that platform and TotalSeq™ with that platform. - Application Notes
-
Additional reported applications (for the relevant formats) include: immunohistochemistry on frozen tissue sections1 and spatial biology (IBEX)2,3.
- Additional Product Notes
-
TotalSeq™-D reagents are designed to profile protein expression at single cell level. The Mission Bio Tapestri platform and sequencer (e.g. Illumina analyzers) are required. Please contact technical support for more information, or visit biolegend.com/totalseq/single-cell-dna
The barcode flanking sequences are CGAGATGACTACGCTACTCATGG (PCR handle), and GAGCCGATCTAGTATCTCAGT*C*G (capture sequence). * indicates a phosphorothioated bond, to prevent nuclease degradation.
View more applications data for this product in our Application Technical Notes. -
Application References
(PubMed link indicates BioLegend citation) - RRID
-
AB_2904349 (BioLegend Cat. No. 330123)
Antigen Details
- Distribution
-
Dendritic cells
- Cell Type
- Dendritic cells
- Biology Area
- Immunology, Innate Immunity
- Molecular Family
- Adhesion Molecules, CD Molecules
- Antigen References
-
1. Granelli-Piperno A, et al. 2005. J Immunol. 175:4265.
- Gene ID
- 30835 View all products for this Gene ID
- UniProt
- View information about CD209 on UniProt.org
Related FAQs
Other Formats
View All CD209 Reagents Request Custom ConjugationDescription | Clone | Applications |
---|---|---|
Purified anti-human CD209 (DC-SIGN) | 9E9A8 | FC,IHC-F |
FITC anti-human CD209 (DC-SIGN) | 9E9A8 | FC |
PE anti-human CD209 (DC-SIGN) | 9E9A8 | FC |
APC anti-human CD209 (DC-SIGN) | 9E9A8 | FC |
PerCP/Cyanine5.5 anti-human CD209 (DC-SIGN) | 9E9A8 | FC |
Alexa Fluor® 647 anti-human CD209 (DC-SIGN) | 9E9A8 | FC,ICC,SB |
PE/Cyanine7 anti-human CD209 (DC-SIGN) | 9E9A8 | FC |
APC/Fire™ 750 anti-human CD209 (DC-SIGN) | 9E9A8 | FC |
Brilliant Violet 421™ anti-human CD209 (DC-SIGN) | 9E9A8 | FC |
TotalSeq™-A0597 anti-human CD209 (DC-SIGN) | 9E9A8 | PG |
TotalSeq™-C0597 anti-human CD209 (DC-SIGN) | 9E9A8 | PG |
TotalSeq™-B0597 anti-human CD209 (DC-SIGN) | 9E9A8 | PG |
TotalSeq™-D0597 anti-human CD209 (DC-SIGN) | 9E9A8 | PG |
PE/Dazzle™ 594 anti-human CD209 (DC-SIGN) | 9E9A8 | FC |
APC/Cyanine7 anti-human CD209 (DC-SIGN) | 9E9A8 | FC |
Compare Data Across All Formats
This data display is provided for general comparisons between formats.
Your actual data may vary due to variations in samples, target cells, instruments and their settings, staining conditions, and other factors.
If you need assistance with selecting the best format contact our expert technical support team.
-
Purified anti-human CD209 (DC-SIGN)
-
FITC anti-human CD209 (DC-SIGN)
-
PE anti-human CD209 (DC-SIGN)
-
APC anti-human CD209 (DC-SIGN)
-
PerCP/Cyanine5.5 anti-human CD209 (DC-SIGN)
-
Alexa Fluor® 647 anti-human CD209 (DC-SIGN)
-
PE/Cyanine7 anti-human CD209 (DC-SIGN)
-
APC/Fire™ 750 anti-human CD209 (DC-SIGN)
-
Brilliant Violet 421™ anti-human CD209 (DC-SIGN)
-
TotalSeq™-A0597 anti-human CD209 (DC-SIGN)
-
TotalSeq™-C0597 anti-human CD209 (DC-SIGN)
-
TotalSeq™-B0597 anti-human CD209 (DC-SIGN)
-
TotalSeq™-D0597 anti-human CD209 (DC-SIGN)
-
PE/Dazzle™ 594 anti-human CD209 (DC-SIGN)
-
APC/Cyanine7 anti-human CD209 (DC-SIGN)
Follow Us