- Clone
- MHK-49 (See other available formats)
- Regulatory Status
- RUO
- Other Names
- Immunoglobulin light chain κ
- Isotype
- Mouse IgG1, κ
- Barcode Sequence
- AGCTCAGCCAGTATG
- Ave. Rating
- Submit a Review
- Product Citations
- publications
Cat # | Size | Price | Quantity Check Availability | Save | ||
---|---|---|---|---|---|---|
316537 | 10 µg | 369 CHF |
The MHK-49 antibody reacts with both soluble and membrane human immunoglobulin light chain kappa (κ). It does not react with human immunoglobulin light chain lambda (λ) or heavy chain. The MHK-49 antibody can be used as primary or secondary reagent for immunofluorescent staining or ELISA analysis.
Product DetailsProduct Details
- Verified Reactivity
- Human
- Reported Reactivity
- Cynomolgus
- Antibody Type
- Monoclonal
- Host Species
- Mouse
- Immunogen
- Human Ig cocktail
- Formulation
- Phosphate-buffered solution, pH 7.2, containing 0.09% sodium azide and EDTA
- Preparation
- The antibody was purified by chromatography and conjugated with TotalSeq™-D oligomer under optimal conditions.
- Concentration
- 0.5 mg/mL
- Storage & Handling
- The antibody solution should be stored undiluted between 2°C and 8°C. Do not freeze.
- Application
-
PG - Quality tested
- Recommended Usage
-
Each lot of this antibody is quality control tested by immunofluorescent staining with flow cytometric analysis and the oligomer sequence is confirmed by sequencing. TotalSeq™-D antibodies are compatible with Mission Bio’s Tapestri Single-Cell Sequencing Platform for simultaneous detection of DNA and Protein.
To maximize performance, it is strongly recommended that the reagent be titrated for each application, and that you centrifuge the antibody dilution before adding to the cells at 14,000xg at 2 - 8°C for 10 minutes. Carefully pipette out the liquid avoiding the bottom of the tube and add to the cell suspension. For Proteogenomics analysis, the suggested starting amount of this reagent for titration is ≤ 1.0 µg per million cells in 100 µL volume. Refer to the corresponding TotalSeq™ protocol for specific staining instructions.
Buyer is solely responsible for determining whether Buyer has all intellectual property rights that are necessary for Buyer's intended uses of the BioLegend TotalSeq™ products. For example, for any technology platform Buyer uses with TotalSeq™, it is Buyer's sole responsibility to determine whether it has all necessary third party intellectual property rights to use that platform and TotalSeq™ with that platform. - Additional Product Notes
-
TotalSeq™-D reagents are designed to profile protein expression at single cell level. The Mission Bio Tapestri platform and sequencer (e.g. Illumina analyzers) are required. Please contact technical support for more information, or visit biolegend.com/totalseq/single-cell-dna
The barcode flanking sequences are CGAGATGACTACGCTACTCATGG (PCR handle), and GAGCCGATCTAGTATCTCAGT*C*G (capture sequence). * indicates a phosphorothioated bond, to prevent nuclease degradation.
View more applications data for this product in our Application Technical Notes. -
Application References
(PubMed link indicates BioLegend citation) -
- Lockridge JL, et al. 2013. Biol. Blood Marrow Transplant 9:1310-22. (ELISA)
- RRID
-
AB_2922549 (BioLegend Cat. No. 316537)
Antigen Details
- Structure
- Ig family
- Distribution
-
B cells
- Cell Type
- B cells
- Biology Area
- Immunology
- Gene ID
- 3514 View all products for this Gene ID
- UniProt
- View information about Ig light chain kappa on UniProt.org
Related Pages & Pathways
Pages
Related FAQs
Other Formats
View All Ig light chain κ Reagents Request Custom ConjugationCompare Data Across All Formats
This data display is provided for general comparisons between formats.
Your actual data may vary due to variations in samples, target cells, instruments and their settings, staining conditions, and other factors.
If you need assistance with selecting the best format contact our expert technical support team.
-
Purified anti-human Ig light chain κ
Over night cultured human peripheral blood lymphocytes stain... -
Biotin anti-human Ig light chain κ
Human peripheral blood lymphocytes stained with biotinylated... -
FITC anti-human Ig light chain κ
Human peripheral blood lymphocytes stained with MHK-49 FITC -
PE anti-human Ig light chain κ
CD19+ human B-lymphocytes stained with MHL-38 (an... -
APC anti-human Ig light chain κ
Human peripheral blood mononuclear cells stained with MHK-49... -
Alexa Fluor® 488 anti-human Ig light chain κ
Overnight cultured human peripheral blood lymphocytes were s... -
Alexa Fluor® 647 anti-human Ig light chain κ
Human peripheral blood lymphocytes stained with MHK-49 Alexa... -
PerCP/Cyanine5.5 anti-human Ig light chain κ
Overnight cultured human peripheral blood lymphocytes were s... -
Pacific Blue™ anti-human Ig light chain κ
Human peripheral blood lymphocytes were stained with CD19 AP... -
PE/Cyanine7 anti-human Ig light chain κ
Overnight cultured human peripheral blood lymphocytes were s... -
APC/Cyanine7 anti-human Ig light chain κ
Human peripheral blood lymphocytes were stained with anti-hu... -
Brilliant Violet 421™ anti-human Ig light chain κ
Human peripheral blood lymphocytes were stained with CD19 PE... -
Alexa Fluor® 700 anti-human Ig light chain κ
Human peripheral blood lymphocytes were stained with CD19 FI... -
Purified anti-human Ig light chain κ (Maxpar® Ready)
Human PBMCs stained with 142Nd-anti-CD19 (HIB19) and 160Gd-a... -
APC/Fire™ 750 anti-human Ig light chain κ
Overnight cultured human peripheral blood lymphocytes were s... -
TotalSeq™-A0894 anti-human Ig light chain κ
-
TotalSeq™-C0894 anti-human Ig light chain κ
-
TotalSeq™-B0894 anti-human Ig light chain κ
-
TotalSeq™-D0894 anti-human Ig light chain κ
-
PE/Dazzle™ 594 anti-human Ig light chain κ
Overnight cultured human peripheral blood lymphocytes were s... -
Spark Red™ 718 anti-human Ig light chain κ (Flexi-Fluor™)
-
PE anti-human Ig light chain κ
Typical results from overnight cultured human peripheral blo... -
FITC anti-human Ig light chain κ
Typical results from overnight cultured human peripheral blo... -
Pacific Blue™ anti-human Ig light chain κ
Typical results from overnight cultured human peripheral blo... -
APC anti-human Ig light chain κ
Typical results from overnight cultured human peripheral blo...
Follow Us