TotalSeq™-D0026 anti-human CD47 Antibody

Pricing & Availability
Clone
CC2C6 (See other available formats)
Regulatory Status
RUO
Other Names
Rh-associated protein, gp42, integrin-associated protein, IAP, neurophilin
Isotype
Mouse IgG1, κ
Barcode Sequence
GCATTCTGTCACCTA
Ave. Rating
Submit a Review
Product Citations
publications
Cat # Size Price Quantity Check Availability Save
323137 10 µg 296€
Check Availability


Need larger quantities of this item?
Request Bulk Quote
Description

CD47 also known as Rh-associated protein, gp42, integrin-associated protein (IAP), and neurophilin, is a 42-52 kD member of the immunoglobulin superfamily containing a five-pass transmembrane attachment. Two splice variants have been described in the cytoplasmic tail, the shorter form is expressed in bone-marrow-derived cells, endothelial cells, and fibroblasts while the longer form is expressed by neural tissues. CD47 expression is widely distributed in hematopoietic cells including thymocytes, T cells, B cells, monocytes, platelets, and erythrocytes as well as epithelial cells, endothelial cells, fibroblasts, and neural tissues. CD47 functions as an adhesion molecule and thrombospondin receptor and is non-covalently associated with β3 integrins CD51/CD61, CD41/CD61. Thrombospondin is a ligand for CD47; in the absence of CD47 mice show defects in host defense and β3 integrin-dependent ligand binding, migration, and cellular activation. CD47 is also part of the Rh complex on erythrocytes. The CC2C6 antibody recognizes human CD47 and has been shown to be useful for flow cytometry.

Product Details
Technical Data Sheet (pdf)

Product Details

Verified Reactivity
Human
Reported Reactivity
African Green, Baboon, Cynomolgus, Rhesus
Antibody Type
Monoclonal
Host Species
Mouse
Immunogen
CCRF-CEM T-cell line
Formulation
Phosphate-buffered solution, pH 7.2, containing 0.09% sodium azide and EDTA
Preparation
The antibody was purified by chromatography and conjugated with TotalSeq™-D oligomer under optimal conditions.
Concentration
0.5 mg/mL
Storage & Handling
The antibody solution should be stored undiluted between 2°C and 8°C. Do not freeze.
Application

PG - Quality tested

Recommended Usage

Each lot of this antibody is quality control tested by immunofluorescent staining with flow cytometric analysis and the oligomer sequence is confirmed by sequencing. TotalSeq™-D antibodies are compatible with Mission Bio’s Tapestri Single-Cell Sequencing Platform for simultaneous detection of DNA and Protein.

To maximize performance, it is strongly recommended that the reagent be titrated for each application, and that you centrifuge the antibody dilution before adding to the cells at 14,000xg at 2 - 8°C for 10 minutes. Carefully pipette out the liquid avoiding the bottom of the tube and add to the cell suspension. For Proteogenomics analysis, the suggested starting amount of this reagent for titration is ≤ 1.0 µg per million cells in 100 µL volume. Refer to the corresponding TotalSeq™ protocol for specific staining instructions.


Buyer is solely responsible for determining whether Buyer has all intellectual property rights that are necessary for Buyer's intended uses of the BioLegend TotalSeq™ products. For example, for any technology platform Buyer uses with TotalSeq™, it is Buyer's sole responsibility to determine whether it has all necessary third party intellectual property rights to use that platform and TotalSeq™ with that platform.
Application Notes

The CC2C6 monoclonal antibody can block the binding of HCD47 antibody to CD47.

Additional reported applications (for the relevant formats) include: blocking2

Additional Product Notes

TotalSeq™-D reagents are designed to profile protein expression at single cell level. The Mission Bio Tapestri platform and sequencer (e.g. Illumina analyzers) are required. Please contact technical support for more information, or visit biolegend.com/totalseq/single-cell-dna

The barcode flanking sequences are CGAGATGACTACGCTACTCATGG (PCR handle), and GAGCCGATCTAGTATCTCAGT*C*G (capture sequence). * indicates a phosphorothioated bond, to prevent nuclease degradation.

View more applications data for this product in our Application Technical Notes.

Application References

(PubMed link indicates BioLegend citation)
  1. Seiffert M, et al. 1999. Blood 94:3633.
  2. Leclair P, et al. 2018. Cell Death Dis. 5:544 (Block)
RRID
AB_2894565 (BioLegend Cat. No. 323137)

Antigen Details

Structure
Member of the immunoglobulin superfamily, 42-52 kD protein with a five-pass transmembrane attachment. Two splice variants have been described in the cytoplasmic tail.
Distribution

Wide distribution in hematopoietic cells including thymocytes, T cells, B cells, platelets, and erythrocytes as well as epithelial cells, endothelial cells, fibroblasts, and neural tissues.

Function
Adhesion molecule and thrombospondin receptor. In the absence of CD47, mice show defects in host defense and beta 3 integrin-dependent ligand binding, migration, and cellular activation. CD47 is a part of the Rh complex on erythrocytes.
Ligand/Receptor
Non-covalently associated with ß3 integrins CD51/CD61, CD41/CD61. Thrombospondin is a ligand for CD47.
Cell Type
B cells, Endothelial cells, Epithelial cells, Erythrocytes, Fibroblasts, Platelets, T cells, Thymocytes
Biology Area
Immunology
Molecular Family
CD Molecules
Antigen References

1. Anstee DJ, et al. 1995. In Leucocyte Typing V (Schlossman ed.) Oxford University Press Oxford pp233-234.
2. Brown E, et al. 1990. J. Cell Biol. 111:2785.
3. Gao AG, et al. 1996. J. Biol. Chem. 271:21.
4. Lindberg FP, et al. 1994. J. Biol. Chem. 269:1567.

Gene ID
961 View all products for this Gene ID
UniProt
View information about CD47 on UniProt.org
Go To Top Version: 1    Revision Date: 07/15/2021

For Research Use Only. Not for diagnostic or therapeutic use.

 

This product is supplied subject to the terms and conditions, including the limited license, located at www.biolegend.com/terms) ("Terms") and may be used only as provided in the Terms. Without limiting the foregoing, BioLegend products may not be used for any Commercial Purpose as defined in the Terms, resold in any form, used in manufacturing, or reverse engineered, sequenced, or otherwise studied or used to learn its design or composition without express written approval of BioLegend. Regardless of the information given in this document, user is solely responsible for determining any license requirements necessary for user’s intended use and assumes all risk and liability arising from use of the product. BioLegend is not responsible for patent infringement or any other risks or liabilities whatsoever resulting from the use of its products.

 

BioLegend, the BioLegend logo, and all other trademarks are property of BioLegend, Inc. or their respective owners, and all rights are reserved.

 

8999 BioLegend Way, San Diego, CA 92121 www.biolegend.com
Toll-Free Phone: 1-877-Bio-Legend (246-5343) Phone: (858) 768-5800 Fax: (877) 455-9587

This data display is provided for general comparisons between formats.
Your actual data may vary due to variations in samples, target cells, instruments and their settings, staining conditions, and other factors.
If you need assistance with selecting the best format contact our expert technical support team.

ProductsHere

Login / Register
Remember me
Forgot your password? Reset password?
Create an Account