- Clone
- CC2C6 (See other available formats)
- Regulatory Status
- RUO
- Other Names
- Rh-associated protein, gp42, integrin-associated protein, IAP, neurophilin
- Isotype
- Mouse IgG1, κ
- Barcode Sequence
- GCATTCTGTCACCTA
- Ave. Rating
- Submit a Review
- Product Citations
- publications
Cat # | Size | Price | Quantity Check Availability | Save | ||
---|---|---|---|---|---|---|
323137 | 10 µg | 296€ |
CD47 also known as Rh-associated protein, gp42, integrin-associated protein (IAP), and neurophilin, is a 42-52 kD member of the immunoglobulin superfamily containing a five-pass transmembrane attachment. Two splice variants have been described in the cytoplasmic tail, the shorter form is expressed in bone-marrow-derived cells, endothelial cells, and fibroblasts while the longer form is expressed by neural tissues. CD47 expression is widely distributed in hematopoietic cells including thymocytes, T cells, B cells, monocytes, platelets, and erythrocytes as well as epithelial cells, endothelial cells, fibroblasts, and neural tissues. CD47 functions as an adhesion molecule and thrombospondin receptor and is non-covalently associated with β3 integrins CD51/CD61, CD41/CD61. Thrombospondin is a ligand for CD47; in the absence of CD47 mice show defects in host defense and β3 integrin-dependent ligand binding, migration, and cellular activation. CD47 is also part of the Rh complex on erythrocytes. The CC2C6 antibody recognizes human CD47 and has been shown to be useful for flow cytometry.
Product DetailsProduct Details
- Verified Reactivity
- Human
- Reported Reactivity
- African Green, Baboon, Cynomolgus, Rhesus
- Antibody Type
- Monoclonal
- Host Species
- Mouse
- Immunogen
- CCRF-CEM T-cell line
- Formulation
- Phosphate-buffered solution, pH 7.2, containing 0.09% sodium azide and EDTA
- Preparation
- The antibody was purified by chromatography and conjugated with TotalSeq™-D oligomer under optimal conditions.
- Concentration
- 0.5 mg/mL
- Storage & Handling
- The antibody solution should be stored undiluted between 2°C and 8°C. Do not freeze.
- Application
-
PG - Quality tested
- Recommended Usage
-
Each lot of this antibody is quality control tested by immunofluorescent staining with flow cytometric analysis and the oligomer sequence is confirmed by sequencing. TotalSeq™-D antibodies are compatible with Mission Bio’s Tapestri Single-Cell Sequencing Platform for simultaneous detection of DNA and Protein.
To maximize performance, it is strongly recommended that the reagent be titrated for each application, and that you centrifuge the antibody dilution before adding to the cells at 14,000xg at 2 - 8°C for 10 minutes. Carefully pipette out the liquid avoiding the bottom of the tube and add to the cell suspension. For Proteogenomics analysis, the suggested starting amount of this reagent for titration is ≤ 1.0 µg per million cells in 100 µL volume. Refer to the corresponding TotalSeq™ protocol for specific staining instructions.
Buyer is solely responsible for determining whether Buyer has all intellectual property rights that are necessary for Buyer's intended uses of the BioLegend TotalSeq™ products. For example, for any technology platform Buyer uses with TotalSeq™, it is Buyer's sole responsibility to determine whether it has all necessary third party intellectual property rights to use that platform and TotalSeq™ with that platform. - Application Notes
-
The CC2C6 monoclonal antibody can block the binding of HCD47 antibody to CD47.
Additional reported applications (for the relevant formats) include: blocking2 - Additional Product Notes
-
TotalSeq™-D reagents are designed to profile protein expression at single cell level. The Mission Bio Tapestri platform and sequencer (e.g. Illumina analyzers) are required. Please contact technical support for more information, or visit biolegend.com/totalseq/single-cell-dna
The barcode flanking sequences are CGAGATGACTACGCTACTCATGG (PCR handle), and GAGCCGATCTAGTATCTCAGT*C*G (capture sequence). * indicates a phosphorothioated bond, to prevent nuclease degradation.
View more applications data for this product in our Application Technical Notes. -
Application References
(PubMed link indicates BioLegend citation) -
- Seiffert M, et al. 1999. Blood 94:3633.
- Leclair P, et al. 2018. Cell Death Dis. 5:544 (Block)
- RRID
-
AB_2894565 (BioLegend Cat. No. 323137)
Antigen Details
- Structure
- Member of the immunoglobulin superfamily, 42-52 kD protein with a five-pass transmembrane attachment. Two splice variants have been described in the cytoplasmic tail.
- Distribution
-
Wide distribution in hematopoietic cells including thymocytes, T cells, B cells, platelets, and erythrocytes as well as epithelial cells, endothelial cells, fibroblasts, and neural tissues.
- Function
- Adhesion molecule and thrombospondin receptor. In the absence of CD47, mice show defects in host defense and beta 3 integrin-dependent ligand binding, migration, and cellular activation. CD47 is a part of the Rh complex on erythrocytes.
- Ligand/Receptor
- Non-covalently associated with ß3 integrins CD51/CD61, CD41/CD61. Thrombospondin is a ligand for CD47.
- Cell Type
- B cells, Endothelial cells, Epithelial cells, Erythrocytes, Fibroblasts, Platelets, T cells, Thymocytes
- Biology Area
- Immunology
- Molecular Family
- CD Molecules
- Antigen References
-
1. Anstee DJ, et al. 1995. In Leucocyte Typing V (Schlossman ed.) Oxford University Press Oxford pp233-234.
2. Brown E, et al. 1990. J. Cell Biol. 111:2785.
3. Gao AG, et al. 1996. J. Biol. Chem. 271:21.
4. Lindberg FP, et al. 1994. J. Biol. Chem. 269:1567. - Gene ID
- 961 View all products for this Gene ID
- UniProt
- View information about CD47 on UniProt.org
Other Formats
View All CD47 Reagents Request Custom ConjugationDescription | Clone | Applications |
---|---|---|
Purified anti-human CD47 | CC2C6 | FC,ICC |
Biotin anti-human CD47 | CC2C6 | FC |
FITC anti-human CD47 | CC2C6 | FC |
PE anti-human CD47 | CC2C6 | FC |
PerCP/Cyanine5.5 anti-human CD47 | CC2C6 | FC |
PE/Cyanine7 anti-human CD47 | CC2C6 | FC |
APC/Fire™ 750 anti-human CD47 | CC2C6 | FC |
Alexa Fluor® 647 anti-human CD47 | CC2C6 | FC |
Alexa Fluor® 700 anti-human CD47 | CC2C6 | FC |
APC anti-human CD47 | CC2C6 | FC |
Pacific Blue™ anti-human CD47 | CC2C6 | FC |
Brilliant Violet 421™ anti-human CD47 | CC2C6 | FC |
Brilliant Violet 605™ anti-human CD47 | CC2C6 | FC |
TotalSeq™-A0026 anti-human CD47 | CC2C6 | PG |
TotalSeq™-C0026 anti-human CD47 | CC2C6 | PG |
PE/Dazzle™ 594 anti-human CD47 Antibody | CC2C6 | FC |
TotalSeq™-B0026 anti-human CD47 Antibody | CC2C6 | PG |
TotalSeq™-D0026 anti-human CD47 | CC2C6 | PG |
Compare Data Across All Formats
This data display is provided for general comparisons between formats.
Your actual data may vary due to variations in samples, target cells, instruments and their settings, staining conditions, and other factors.
If you need assistance with selecting the best format contact our expert technical support team.
-
Purified anti-human CD47
Human peripheral blood lymphocytes stained with purified CC2... MCF-7 breast cancer cell line was stained with anti-human CD... -
Biotin anti-human CD47
Human peripheral blood lymphocytes stained with biotinylated... -
FITC anti-human CD47
Human peripheral blood lymphocytes stained with CC2C6 FITC -
PE anti-human CD47
Human peripheral blood lymphocytes stained with CC2C6 PE -
PerCP/Cyanine5.5 anti-human CD47
Human peripheral blood lymphocytes were stained with CD47 (c... -
PE/Cyanine7 anti-human CD47
Human peripheral blood monocytes were stained with CD47 (clo... -
APC/Fire™ 750 anti-human CD47
Human peripheral blood monocytes were stained with CD47 (clo... -
Alexa Fluor® 647 anti-human CD47
Human peripheral blood monocytes were stained with CD47 (clo... -
Alexa Fluor® 700 anti-human CD47
Human peripheral blood lymphocytes were stained with CD47 (c... -
APC anti-human CD47
Human peripheral blood lymphocytes were stained with CD47 (c... -
Pacific Blue™ anti-human CD47
Human peripheral blood lymphocytes were stained with CD47 (c... -
Brilliant Violet 421™ anti-human CD47
Human peripheral blood monocytes were stained with CD47 (cl... -
Brilliant Violet 605™ anti-human CD47
Human peripheral blood monocytes were stained with CD47 (clo... -
TotalSeq™-A0026 anti-human CD47
-
TotalSeq™-C0026 anti-human CD47
-
PE/Dazzle™ 594 anti-human CD47 Antibody
Human peripheral blood lymphocytes were stained with anti-hu... -
TotalSeq™-B0026 anti-human CD47 Antibody
-
TotalSeq™-D0026 anti-human CD47
Follow Us