- Clone
- A15153G (See other available formats)
- Regulatory Status
- RUO
- Other Names
- T-cell immunoreceptor with Ig and ITIM domains, VSIG9, VSTM3, WUCAM
- Isotype
- Mouse IgG2a, κ
- Barcode Sequence
- TTGCTTACCGCCAGA
- Ave. Rating
- Submit a Review
- Product Citations
- publications
Cat # | Size | Price | Quantity Check Availability | Save | ||
---|---|---|---|---|---|---|
372739 | 10 µg | 296€ |
T cell immunoreceptor with Ig and ITIM domains (TIGIT), also known as VSTM3 or WUCAM, is a 26 kD, type I transmembrane protein and is a member of the PVR (poliovirus receptor) family of immunoglobulin-like domain containing proteins. TIGIT is expressed on activated T cells, follicular T helper, memory, and regulatory T cells as well as on NK cells. TIGIT is a negative regulator of NK and T cell activation. Expression of TIGIT is associated with decreased functionality of CD8 T cells in chronic viral infection and tumors. TIGIT also promotes the differentiation of tolerogenic phenotype in dendritic cells with an increased secretion of IL-10 and a diminished production of IL-12.
Product DetailsProduct Details
- Verified Reactivity
- Human
- Antibody Type
- Monoclonal
- Host Species
- Mouse
- Immunogen
- Recombinant Human TIGIT.
- Formulation
- Phosphate-buffered solution, pH 7.2, containing 0.09% sodium azide and EDTA
- Preparation
- The antibody was purified by chromatography and conjugated with TotalSeq™-D oligomer under optimal conditions.
- Concentration
- 0.5 mg/mL
- Storage & Handling
- The antibody solution should be stored undiluted between 2°C and 8°C. Do not freeze.
- Application
-
PG - Quality tested
- Recommended Usage
-
Each lot of this antibody is quality control tested by immunofluorescent staining with flow cytometric analysis and the oligomer sequence is confirmed by sequencing. TotalSeq™-D antibodies are compatible with Mission Bio’s Tapestri Single-Cell Sequencing Platform for simultaneous detection of DNA and Protein.
To maximize performance, it is strongly recommended that the reagent be titrated for each application, and that you centrifuge the antibody dilution before adding to the cells at 14,000xg at 2 - 8°C for 10 minutes. Carefully pipette out the liquid avoiding the bottom of the tube and add to the cell suspension. For Proteogenomics analysis, the suggested starting amount of this reagent for titration is ≤ 1.0 µg per million cells in 100 µL volume. Refer to the corresponding TotalSeq™ protocol for specific staining instructions.
Buyer is solely responsible for determining whether Buyer has all intellectual property rights that are necessary for Buyer's intended uses of the BioLegend TotalSeq™ products. For example, for any technology platform Buyer uses with TotalSeq™, it is Buyer's sole responsibility to determine whether it has all necessary third party intellectual property rights to use that platform and TotalSeq™ with that platform. - Application Notes
-
This clone can suppress anti-CD3 induced T cell proliferation in vitro based on in-house testing.
This clone has been tested in-house and determined to not be suitable for applications in immunohistochemistry of paraffin-embedded tissue sections (IHC-P).
Additional reported applications (for the relevant formats) include: Blocking1. - Additional Product Notes
-
TotalSeq™-D reagents are designed to profile protein expression at single cell level. The Mission Bio Tapestri platform and sequencer (e.g. Illumina analyzers) are required. Please contact technical support for more information, or visit biolegend.com/totalseq/single-cell-dna
The barcode flanking sequences are CGAGATGACTACGCTACTCATGG (PCR handle), and GAGCCGATCTAGTATCTCAGT*C*G (capture sequence). * indicates a phosphorothioated bond, to prevent nuclease degradation.
View more applications data for this product in our Application Technical Notes. - Application References
-
- Stamm H, et al. 2018. Oncogene. Pubmed
- RRID
-
AB_2892456 (BioLegend Cat. No. 372739)
Antigen Details
- Structure
- 26kD; type I transmembrane protein, Ig-like V-type domain, ITIM motif.
- Distribution
-
Activated T cells, Regulatory T cells (Treg), Follicular Helper T cells (TFH), NK cells.
- Function
- Cell signaling, negative regulation of T cells, T cell tolerance, T cell anergy.
- Ligand/Receptor
- CD155 (PVR), CD112 (PVRL2, NECTIN-2).
- Cell Type
- NK cells, T cells, Tfh, Tregs
- Biology Area
- Cell Adhesion, Cell Biology, Immunology, Inhibitory Molecules, Signal Transduction
- Molecular Family
- Adhesion Molecules, Immune Checkpoint Receptors
- Antigen References
-
1. Stanietsky N, et al. 2009. Proc. Natl. Acad. Sci. 106:17858.
2. Yu X, et al. 2009. Nat. Immunol. 10:48.
3. Johnston R, et al. 2014. Cancer Cell. 26:923. - Gene ID
- 201633 View all products for this Gene ID
- UniProt
- View information about TIGIT on UniProt.org
Related Pages & Pathways
Pages
Related FAQs
Other Formats
View All TIGIT (VSTM3) Reagents Request Custom ConjugationCompare Data Across All Formats
This data display is provided for general comparisons between formats.
Your actual data may vary due to variations in samples, target cells, instruments and their settings, staining conditions, and other factors.
If you need assistance with selecting the best format contact our expert technical support team.
-
Purified anti-human TIGIT (VSTM3)
Human peripheral blood leukocytes were stained with CD3 FITC... Human PBMCs were labeled with CFSE. Cells were cultured in ... -
APC/Fire™ 750 anti-human TIGIT (VSTM3)
Human peripheral blood leukocytes were stained with CD3 FITC... -
APC anti-human TIGIT (VSTM3)
Human peripheral blood leukocytes were stained with CD3 FITC... -
PE anti-human TIGIT (VSTM3)
Human peripheral blood leukocytes were stained with CD3 APC ... -
Brilliant Violet 421™ anti-human TIGIT (VSTM3)
Human peripheral blood leukocytes were stained with CD3 FITC... -
Brilliant Violet 605™ anti-human TIGIT (VSTM3)
Human peripheral blood leukocytes were stained with CD3 FITC... -
PE/Dazzle™ 594 anti-human TIGIT (VSTM3)
Human peripheral blood leukocytes were stained with CD3 FITC... -
PerCP/Cyanine5.5 anti-human TIGIT (VSTM3)
Human peripheral blood leukocytes were stained with CD3 APC ... -
PE/Cyanine7 anti-human TIGIT (VSTM3)
Human peripheral blood leukocytes were stained with FITC CD3... -
Ultra-LEAF™ Purified anti-human TIGIT (VSTM3)
Human peripheral blood leukocytes were stained with CD3 FITC... Human PBMCs were labeled with CFSE. Cells were cultured in ... -
Biotin anti-human TIGIT (VSTM3)
Human peripheral blood leukocytes were stained with CD3 FITC... -
Alexa Fluor® 647 anti-human TIGIT (VSTM3)
Human peripheral blood lymphocytes were stained with CD3 PE ... -
TotalSeq™-A0089 anti-human TIGIT (VSTM3)
-
TotalSeq™-B0089 anti-human TIGIT (VSTM3)
-
TotalSeq™-C0089 anti-human TIGIT (VSTM3)
-
KIRAVIA Blue 520™ anti-human TIGIT (VSTM3)
Human peripheral blood lymphocytes were stained with CD3 APC... -
APC/Cyanine7 anti-human TIGIT (VSTM3)
Human peripheral blood lymphocytes were stained with CD3 PE ... -
Brilliant Violet 510™ anti-human TIGIT (VSTM3)
Human peripheral blood lymphocytes were stained with CD3 APC... -
Brilliant Violet 785™ anti-human TIGIT (VSTM3) Antibody
Human peripheral blood lymphocytes were stained with CD3 PE ... -
TotalSeq™-D0089 anti-human TIGIT (VSTM3)
-
Brilliant Violet 711™ anti-human TIGIT (VSTM3)
Human peripheral blood lymphocytes were stained with CD3 Ale... -
PE/Fire™ 640 anti-human TIGIT (VSTM3)
Human peripheral blood leukocytes were stained with anti-hum... -
PE/Fire™ 810 anti-human TIGIT (VSTM3)
Human peripheral blood lymphocyte were stained with anti-hum... -
PE/Cyanine5 anti-human TIGIT (VSTM3)
Human peripheral blood leukocytes were stained with anti-hum... -
PerCP/Fire™ 806 anti-human TIGIT (VSTM3)
Human peripheral blood lymphocytes were stained with anti-hu... -
PerCP/Fire™ 780 anti-human TIGIT (VSTM3)
Human lysed whole blood cells were stained with anti-human C... -
Spark Red™ 718 anti-human TIGIT (VSTM3) (Flexi-Fluor™)
-
PE/Fire™ 700 anti-human TIGIT (VSTM3)
Human peripheral blood lymphocytes were stained with anti-hu... -
Brilliant Violet 650™ anti-human TIGIT (VSTM3) Antibody
Human peripheral blood leukocytes were stained with anti-hum...
Follow Us