TotalSeq™-D0100 anti-human CD20 Antibody, CD20, 2H7

Clone: 2H7 (See other available formats)
Regulatory Status: RUO
Workshop: IV B201
Other Names: B1, Bp35
Isotype: Mouse IgG2b, κ
Barcode Sequence: TTCTGGGTCCCTAGA
Ave. Rating: Submit a Review
Product Citations: publications

Cat #	Size	Price	Save
302370	10 µg	¥81,180

Description

CD20 is a 33-37 kD, four transmembrane spanning protein, also known as B1 and Bp35. CD20 is expressed on pre-B-cells, resting and activated B cells (not plasma cells), some follicular dendritic cells, and at low levels on a T cell subset. CD20 is heavily phosphorylated on activated B cells and malignant B cells. Homo-oligomeric complexes of CD20 are thought to form Ca²⁺ conductive ion channels in the plasma membrane of B cells. The CD20 molecule is involved in B-cell activation and is associated with various Src family kinases (Lyn, Lck, Fyn). It exists in a complex with MHC class I and II, CD53, CD81, and CD82.

Product Details

Technical data sheet

Product Details

Verified Reactivity: Human, Cynomolgus, Rhesus
Reported Reactivity: Baboon, Capuchin Monkey, Chimpanzee, Pigtailed Macaque, Squirrel Monkey
Antibody Type: Monoclonal
Host Species: Mouse
Immunogen: Human tonsillar B cells
Formulation: Phosphate-buffered solution, pH 7.2, containing 0.09% sodium azide and EDTA
Preparation: The antibody was purified by chromatography and conjugated with TotalSeq™-D oligomer under optimal conditions.
Concentration: 0.5 mg/mL
Storage & Handling: The antibody solution should be stored undiluted between 2°C and 8°C. Do not freeze.
Application: PG - Quality tested
Recommended Usage: Each lot of this antibody is quality control tested by immunofluorescent staining with flow cytometric analysis and the oligomer sequence is confirmed by sequencing. TotalSeq™-D antibodies are compatible with Mission Bio’s Tapestri Single-Cell Sequencing Platform for simultaneous detection of DNA and Protein.

To maximize performance, it is strongly recommended that the reagent be titrated for each application, and that you centrifuge the antibody dilution before adding to the cells at 14,000xg at 2 - 8°C for 10 minutes. Carefully pipette out the liquid avoiding the bottom of the tube and add to the cell suspension. For Proteogenomics analysis, the suggested starting amount of this reagent for titration is ≤ 1.0 µg per million cells in 100 µL volume. Refer to the corresponding TotalSeq™ protocol for specific staining instructions.

Buyer is solely responsible for determining whether Buyer has all intellectual property rights that are necessary for Buyer's intended uses of the BioLegend TotalSeq™ products. For example, for any technology platform Buyer uses with TotalSeq™, it is Buyer's sole responsibility to determine whether it has all necessary third party intellectual property rights to use that platform and TotalSeq™ with that platform.
Application Notes: The epitope recognized by clone 2H7 has been mapped to the sequence YNCEPANPSEKNSPST which lies in the large extracellular loop of human CD20. Additional reported applications (for the relevant formats) include: immunoprecipitation⁴ and immunohistochemical staining of acetone-fixed frozen sections⁵.
Additional Product Notes: TotalSeq™-D reagents are designed to profile protein expression at single cell level. The Mission Bio Tapestri platform and sequencer (e.g. Illumina analyzers) are required. Please contact technical support for more information, or visit biolegend.com/totalseq/single-cell-dna

The barcode flanking sequences are CGAGATGACTACGCTACTCATGG (PCR handle), and GAGCCGATCTAGTATCTCAGT*C*G (capture sequence). * indicates a phosphorothioated bond, to prevent nuclease degradation.

View more applications data for this product in our Application Technical Notes.
RRID: AB_2922531 (BioLegend Cat. No. 302370)

Antigen Details

Structure: Four transmembrane protein (TM4SF), heavily phosphorylated after activation, 33-37 kD
Distribution: B cell, T cell subsets
Function: B cell activation
Ligand/Receptor: Src family tyrosine kinases, MHC class I, II, CD53, CD81, CD82
Cell Type: B cells, T cells
Biology Area: Costimulatory Molecules, Immunology
Molecular Family: CD Molecules
Antigen References: 1. Hultin L, et al. 1993. Cytometry 14:196.
2. Tedder T, et al. 1994. Immunol. Today 15:450.
Gene ID: 931 View all products for this Gene ID
UniProt: View information about CD20 on UniProt.org

Documentation

Reviews

Review This Product

Related Protocols

TotalSeq™-D with Mission Bio Tapestri® Single-Cell DNA + Protein Protocol

Related Products

Description	Clone	Applications

Related Pages & Pathways

Pathways

B cell Development and Activation

Related FAQs

What is the difference between two anti human CD20 clones 2H7 and 1412?: For clone 1412: This clone specifically recognizes cytoplasmic domain of CD20 and thus can only be used for intracellular flow cytometry. In this instance you will need to include the fixation and permeabilization steps. Please follow the intracellular flow cytometry staining protocol.

For clone 2H7: This clone is ok for regular surface staining for CD20 and there is no need for any fixation and permeabilization steps.

Our technical protocols can be found here.

Other Formats

View All CD20 Reagents Request Custom Conjugation

Description	Clone	Applications
APC anti-human CD20	2H7	FC
FITC anti-human CD20	2H7	FC
PE anti-human CD20	2H7	FC
PE/Cyanine5 anti-human CD20	2H7	FC
Purified anti-human CD20	2H7	FC,CyTOF®,IHC-F,IP
APC/Cyanine7 anti-human CD20	2H7	FC
PE/Cyanine7 anti-human CD20	2H7	FC
Alexa Fluor® 488 anti-human CD20	2H7	FC,IHC-F
Alexa Fluor® 647 anti-human CD20	2H7	FC,IHC-F
Pacific Blue™ anti-human CD20	2H7	FC
Alexa Fluor® 700 anti-human CD20	2H7	FC
PerCP anti-human CD20	2H7	FC
PerCP/Cyanine5.5 anti-human CD20	2H7	FC
Brilliant Violet 421™ anti-human CD20	2H7	FC,IHC-F
Brilliant Violet 570™ anti-human CD20	2H7	FC
Brilliant Violet 605™ anti-human CD20	2H7	FC
Brilliant Violet 650™ anti-human CD20	2H7	FC
Brilliant Violet 785™ anti-human CD20	2H7	FC
Brilliant Violet 510™ anti-human CD20	2H7	FC
Brilliant Violet 711™ anti-human CD20	2H7	FC
Purified anti-human CD20 (Maxpar® Ready)	2H7	FC,CyTOF®
PE/Dazzle™ 594 anti-human CD20	2H7	FC
Biotin anti-human CD20	2H7	FC
APC/Fire™ 750 anti-human CD20	2H7	FC
Alexa Fluor® 594 anti-human CD20	2H7	ICC,IHC-F
FITC anti-human CD20	2H7	FC
Pacific Blue™ anti-human CD20	2H7	FC
APC anti-human CD20	2H7	FC
PE/Cyanine7 anti-human CD20	2H7	FC
TotalSeq™-A0100 anti-human CD20	2H7	PG
TotalSeq™-B0100 anti-human CD20	2H7	PG
TotalSeq™-C0100 anti-human CD20	2H7	PG
PerCP/Cyanine5.5 anti-human CD20	2H7	FC
Spark NIR™ 685 anti-human CD20	2H7	FC
Spark YG™ 593 anti-human CD20	2H7	FC
GMP FITC anti-human CD20	2H7	FC
TotalSeq™-D0100 anti-human CD20	2H7	PG
GMP APC anti-human CD20	2H7	FC
Spark Violet™ 500 anti-human CD20	2H7	FC
GMP Pacific Blue™ anti-human CD20	2H7	FC
GMP PerCP/Cyanine5.5 anti-human CD20	2H7	FC
Spark Violet™ 538 anti-human CD20	2H7	FC
APC/Fire™ 750 anti-human CD20	2H7	FC
PE anti-human CD20	2H7	FC
GMP PE/Cyanine7 anti-human CD20	2H7	FC
Spark Blue™ 515 anti-human CD20	2H7	FC
GMP APC/Fire™ 750 anti-human CD20	2H7	FC
GMP PE anti-human CD20	2H7	FC
Spark Blue™ 550 anti-human CD20 (Flexi-Fluor™)	2H7	FC
Spark Blue™ 574 anti-human CD20 (Flexi-Fluor™)	2H7	FC
Spark Red™ 718 anti-human CD20 (Flexi-Fluor™)	2H7	FC
APC/Fire™ 810 anti-human CD20	2H7	FC
Alexa Fluor® 660 anti-human CD20	2H7	FC

Certificate of Analysis

Go To Top Version: 1 Revision Date: 03/23/2022

For Research Use Only. Not for diagnostic or therapeutic use.

This product is supplied subject to the terms and conditions, including the limited license, located at www.biolegend.com/terms) ("Terms") and may be used only as provided in the Terms. Without limiting the foregoing, BioLegend products may not be used for any Commercial Purpose as defined in the Terms, resold in any form, used in manufacturing, or reverse engineered, sequenced, or otherwise studied or used to learn its design or composition without express written approval of BioLegend. Regardless of the information given in this document, user is solely responsible for determining any license requirements necessary for user’s intended use and assumes all risk and liability arising from use of the product. BioLegend is not responsible for patent infringement or any other risks or liabilities whatsoever resulting from the use of its products.

BioLegend, the BioLegend logo, and all other trademarks are property of BioLegend, Inc. or their respective owners, and all rights are reserved.

8999 BioLegend Way, San Diego, CA 92121 www.biolegend.com
Toll-Free Phone: 1-877-Bio-Legend (246-5343) Phone: (858) 768-5800 Fax: (877) 455-9587

This data display is provided for general comparisons between formats.
Your actual data may vary due to variations in samples, target cells, instruments and their settings, staining conditions, and other factors.
If you need assistance with selecting the best format contact our expert technical support team.