TotalSeq™-D0185 anti-human CD11a antibody, CD11a, TS2/4

Clone: TS2/4 (See other available formats)
Regulatory Status: RUO
Workshop: V S160
Other Names: LFA-1α chain, Integrin αL subunit, αL Integrin, ITGAL
Isotype: Mouse IgG1, κ
Barcode Sequence: TATATCCTTGTGAGC
Ave. Rating: Submit a Review
Product Citations: publications

Cat #	Size	Price	Save
350621	10 µg	¥81,180

Description

CD11a is a 170-180 kD type I transmembrane glycoprotein also known as LFA-1α chain and integrin α_L subunit. CD11a non-covalently associates with integrin β₂ (CD18) to form LFA-1. It is expressed on all leukocytes, including B and T lymphocytes, monocytes, macrophages, neutrophils, basophils and eosinophils. It is absent on non-hematopoietic tissues and platelets. CD11a plays a central role in leukocyte cell-cell interactions and is important in lymphocyte costimulation. CD11a/CD18 binds to ICAM-1 (CD54), ICAM-2 (CD102), and ICAM-3 (CD50).

Product Details

Technical data sheet

Product Details

Verified Reactivity: Human
Antibody Type: Monoclonal
Host Species: Mouse
Immunogen: HLA-DR CTL line
Formulation: Phosphate-buffered solution, pH 7.2, containing 0.09% sodium azide and EDTA
Preparation: The antibody was purified by chromatography and conjugated with TotalSeq™-D oligomer under optimal conditions.
Concentration: 0.5 mg/mL
Storage & Handling: The antibody solution should be stored undiluted between 2°C and 8°C. Do not freeze.
Application: PG - Quality tested
Recommended Usage: Each lot of this antibody is quality control tested by immunofluorescent staining with flow cytometric analysis and the oligomer sequence is confirmed by sequencing. TotalSeq™-D antibodies are compatible with Mission Bio’s Tapestri Single-Cell Sequencing Platform for simultaneous detection of DNA and Protein.

To maximize performance, it is strongly recommended that the reagent be titrated for each application, and that you centrifuge the antibody dilution before adding to the cells at 14,000xg at 2 - 8°C for 10 minutes. Carefully pipette out the liquid avoiding the bottom of the tube and add to the cell suspension. For Proteogenomics analysis, the suggested starting amount of this reagent for titration is ≤ 1.0 µg per million cells in 100 µL volume. Refer to the corresponding TotalSeq™ protocol for specific staining instructions.

Buyer is solely responsible for determining whether Buyer has all intellectual property rights that are necessary for Buyer's intended uses of the BioLegend TotalSeq™ products. For example, for any technology platform Buyer uses with TotalSeq™, it is Buyer's sole responsibility to determine whether it has all necessary third party intellectual property rights to use that platform and TotalSeq™ with that platform.
Application Notes: Additional reported applications (for relevant formats) include: immunoprecipitation^{1, 2}. Note: the antibody TS2/4 recognizes the ß-propeller domain of CD11a and only immunoprecipitates the CD11a/CD18 complex.
Additional Product Notes: TotalSeq™-D reagents are designed to profile protein expression at single cell level. The Mission Bio Tapestri platform and sequencer (e.g. Illumina analyzers) are required. Please contact technical support for more information, or visit biolegend.com/totalseq/single-cell-dna

The barcode flanking sequences are CGAGATGACTACGCTACTCATGG (PCR handle), and GAGCCGATCTAGTATCTCAGT*C*G (capture sequence). * indicates a phosphorothioated bond, to prevent nuclease degradation.

View more applications data for this product in our Application Technical Notes.
RRID: AB_2892426 (BioLegend Cat. No. 350621)

Antigen Details

Structure: Integrin, type I transmembrane glycoprotein, noncovalently linked with integrin β₂ (CD18) forms LFA-1, 170-180 kD
Distribution: Leukocytes
Function: Adhesion, costimulation
Ligand/Receptor: ICAM-1(CD54), ICAM-2(CD102), ICAM-3(CD50)
Cell Type: Leukocytes, Tregs
Biology Area: Cell Adhesion, Cell Biology, Costimulatory Molecules, Immunology, Innate Immunity, Neuroinflammation, Neuroscience
Molecular Family: Adhesion Molecules, CD Molecules
Antigen References: 1. Lub M, et al. 1995. Immunol. Today 16:479.
2. Parsons J. 1996. Curr. Opin. Cell Biol. 8:146.
Gene ID: 3683 View all products for this Gene ID
UniProt: View information about CD11a on UniProt.org

Documentation

Reviews

Review This Product

Related Protocols

TotalSeq™-D with Mission Bio Tapestri® Single-Cell DNA + Protein Protocol

Related Products

Description	Clone	Applications

Related Pages & Pathways

Pathways

Related FAQs

There are no FAQs for this product.

Other Formats

View All CD11a Reagents Request Custom Conjugation

Description	Clone	Applications
Purified anti-human CD11a	TS2/4	FC,IP
FITC anti-human CD11a	TS2/4	FC
PE anti-human CD11a	TS2/4	FC
PerCP anti-human CD11a	TS2/4	FC
PE/Cyanine7 anti-human CD11a	TS2/4	FC
APC/Fire™ 750 anti-human CD11a	TS2/4	FC
PerCP/Cyanine5.5 anti-human CD11a	TS2/4	FC
TotalSeq™-A0185 anti-human CD11a	TS2/4	PG
TotalSeq™-C0185 anti-human CD11a	TS2/4	PG
TotalSeq™-B0185 anti-human CD11a	TS2/4	PG
TotalSeq™-D0185 anti-human CD11a	TS2/4	PG

Certificate of Analysis

Go To Top Version: 1 Revision Date: 05/24/2021

For Research Use Only. Not for diagnostic or therapeutic use.

This product is supplied subject to the terms and conditions, including the limited license, located at www.biolegend.com/terms) ("Terms") and may be used only as provided in the Terms. Without limiting the foregoing, BioLegend products may not be used for any Commercial Purpose as defined in the Terms, resold in any form, used in manufacturing, or reverse engineered, sequenced, or otherwise studied or used to learn its design or composition without express written approval of BioLegend. Regardless of the information given in this document, user is solely responsible for determining any license requirements necessary for user’s intended use and assumes all risk and liability arising from use of the product. BioLegend is not responsible for patent infringement or any other risks or liabilities whatsoever resulting from the use of its products.

BioLegend, the BioLegend logo, and all other trademarks are property of BioLegend, Inc. or their respective owners, and all rights are reserved.

8999 BioLegend Way, San Diego, CA 92121 www.biolegend.com
Toll-Free Phone: 1-877-Bio-Legend (246-5343) Phone: (858) 768-5800 Fax: (877) 455-9587

This data display is provided for general comparisons between formats.
Your actual data may vary due to variations in samples, target cells, instruments and their settings, staining conditions, and other factors.
If you need assistance with selecting the best format contact our expert technical support team.