- Clone
- 201A (See other available formats)
- Regulatory Status
- RUO
- Other Names
- CLEC4C, CLECSF11, CLECSF7, DLEC, HECL
- Isotype
- Mouse IgG2a, κ
- Barcode Sequence
- GAGATGTCCGAATTT
- Ave. Rating
- Submit a Review
CD303, also known as BDCA-2 and CLEC4C, is a 38 kD type II transmembrane glycoprotein. It is a member of the C-type lectin superfamily. CD303 is expressed by plasmacytoid dendritic cells (pDCs) and is involved in cell adhesion, signaling, and antigen capture and processing. Crosslinking of CD303 inhibits the production of IFN-α/β and TLR-9 induced pDCs maturation.
Product DetailsProduct Details
- Verified Reactivity
- Human
- Antibody Type
- Monoclonal
- Host Species
- Mouse
- Formulation
- Phosphate-buffered solution, pH 7.2, containing 0.09% sodium azide and EDTA
- Preparation
- The antibody was purified by chromatography and conjugated with TotalSeq™-D oligomer under optimal conditions.
- Concentration
- 0.5 mg/mL
- Storage & Handling
- The antibody solution should be stored undiluted between 2°C and 8°C. Do not freeze.
- Application
-
PG - Quality tested
- Recommended Usage
-
Each lot of this antibody is quality control tested by immunofluorescent staining with flow cytometric analysis and the oligomer sequence is confirmed by sequencing. TotalSeq™-D antibodies are compatible with Mission Bio’s Tapestri Single-Cell Sequencing Platform for simultaneous detection of DNA and Protein.
To maximize performance, it is strongly recommended that the reagent be titrated for each application, and that you centrifuge the antibody dilution before adding to the cells at 14,000xg at 2 - 8°C for 10 minutes. Carefully pipette out the liquid avoiding the bottom of the tube and add to the cell suspension. For Proteogenomics analysis, the suggested starting amount of this reagent for titration is ≤ 1.0 µg per million cells in 100 µL volume. Refer to the corresponding TotalSeq™ protocol for specific staining instructions.
Buyer is solely responsible for determining whether Buyer has all intellectual property rights that are necessary for Buyer's intended uses of the BioLegend TotalSeq™ products. For example, for any technology platform Buyer uses with TotalSeq™, it is Buyer's sole responsibility to determine whether it has all necessary third party intellectual property rights to use that platform and TotalSeq™ with that platform. - Additional Product Notes
-
TotalSeq™-D reagents are designed to profile protein expression at single cell level. The Mission Bio Tapestri platform and sequencer (e.g. Illumina analyzers) are required. Please contact technical support for more information, or visit biolegend.com/totalseq/single-cell-dna
The barcode flanking sequences are CGAGATGACTACGCTACTCATGG (PCR handle), and GAGCCGATCTAGTATCTCAGT*C*G (capture sequence). * indicates a phosphorothioated bond, to prevent nuclease degradation.
View more applications data for this product in our Application Technical Notes. -
Application References
(PubMed link indicates BioLegend citation) - RRID
-
AB_2892429 (BioLegend Cat. No. 354245)
Antigen Details
- Structure
- Type II transmembrane protein, 38 kD, member of the C-type lectin superfamily
- Distribution
-
Plasmacytoid dendritic cells
- Function
- Antigen capture, inhibition of IFN α/β production
- Cell Type
- Dendritic cells
- Biology Area
- Costimulatory Molecules, Immunology, Innate Immunity
- Molecular Family
- Adhesion Molecules, CD Molecules
- Antigen References
-
1. Jähn PS, et al. 2010. Cell Immunol. 265:15.
2. Graham LM and Brown GD. 2009. Cytokine 48:148.
3. Röck J, et al. 2007. Eur. J. Immunol. 37:3564.
4. Dzionek A, et al. 2001. J. Exp. Med. 194:1823. - Gene ID
- 170482 View all products for this Gene ID
- UniProt
- View information about CD303 on UniProt.org
Related FAQs
Other Formats
View All CD303 Reagents Request Custom ConjugationCompare Data Across All Formats
This data display is provided for general comparisons between formats.
Your actual data may vary due to variations in samples, target cells, instruments and their settings, staining conditions, and other factors.
If you need assistance with selecting the best format contact our expert technical support team.
-
APC anti-human CD303 (BDCA-2)
Human peripheral mononuclear cells were stained with CD123 P... -
Purified anti-human CD303 (BDCA-2)
Human peripheral mononuclear cells were stained with purifie... -
PE anti-human CD303 (BDCA-2)
Human peripheral mononuclear cells were stained with CD123 A... -
FITC anti-human CD303 (BDCA-2)
Human peripheral blood mononuclear cells were stained with C... -
PerCP/Cyanine5.5 anti-human CD303 (BDCA-2)
Human peripheral mononuclear cells were stained with anti-hu... -
Brilliant Violet 421™ anti-human CD303 (BDCA-2)
Human peripheral mononuclear cells were stained with CD123 A... -
PE/Cyanine7 anti-human CD303 (BDCA-2)
Human peripheral mononuclear cells were stained with CD123 A... -
Purified anti-human CD303 (BDCA-2) (Maxpar® Ready)
Human PBMCs stained with 151Eu-anti-CD123 (6H6) and 153Eu-an... -
Alexa Fluor® 647 anti-human CD303 (BDCA-2)
Human peripheral mononuclear cells were stained with CD123 P... -
Biotin anti-human CD303 (BDCA-2)
Human peripheral mononuclear cells were stained with CD123 A... -
Brilliant Violet 785™ anti-human CD303 (BDCA-2)
Human peripheral mononuclear cells were stained with CD123 A... -
Brilliant Violet 605™ anti-human CD303 (BDCA-2)
Human peripheral mononuclear cells were stained with CD123 A... -
PE/Dazzle™ 594 anti-human CD303 (BDCA-2)
Human peripheral mononuclear cells were stained with CD123 A... -
Alexa Fluor® 700 anti-human CD303 (BDCA-2)
Human peripheral mononuclear cells were stained with CD123 P... -
Alexa Fluor® 488 anti-human CD303 (BDCA-2)
RBC lysed human blood was stained with CD123 APC and CD303 (... -
Brilliant Violet 510™ anti-human CD303 (BDCA-2)
Human peripheral blood lymphocytes were stained with CD123 A... -
Brilliant Violet 711™ anti-human CD303 (BDCA-2)
Human peripheral blood lymphocytes were stained with CD123 P... -
APC/Fire™ 750 anti-human CD303 (BDCA-2)
Human peripheral blood lymphocytes and monocytes were stain... -
APC/Cyanine7 anti-human CD303 (BDCA-2)
Human peripheral mononuclear cells were stained with with Tr... -
TotalSeq™-A0370 anti-human CD303 (BDCA-2)
-
TotalSeq™-C0370 anti-human CD303 (BDCA-2)
-
TotalSeq™-B0370 anti-human CD303 (BDCA-2)
-
TotalSeq™-D0370 anti-human CD303 (BDCA-2)
-
Spark Blue™ 550 anti-human CD303 (BDCA-2) (Flexi-Fluor™)
-
Spark Red™ 718 anti-human CD303 (BDCA-2) (Flexi-Fluor™)
-
APC/Fire™ 810 anti-human CD303 (BDCA-2)
Human peripheral mononuclear cells were stained with anti-hu... -
Spark Violet™ 538 anti-human CD303 (BDCA-2)
Human peripheral mononuclear cells were stained with anti-hu... -
PerCP/Fire™ 806 anti-human CD303 (BDCA-2)
Human peripheral mononuclear cells were stained with anti-hu...
Follow Us