- Clone
- 5E8 (See other available formats)
- Regulatory Status
- RUO
- Other Names
- CC CKR3, MIP1-alpha receptor like-2, eotaxin receptor, CD193, CCR3
- Isotype
- Mouse IgG2b, κ
- Barcode Sequence
- ACCAATCCTTTCGTC
- Ave. Rating
- Submit a Review
- Product Citations
- publications
CD193, also known as CC-chemokine receptor 3 (CCR3), CC CKR3, MIP1-alpha receptor like-2, and eotaxin receptor, is a member of the G protein-coupled seven transmembrane receptors family. It binds to the CC chemokines eotaxin, eotaxin-2, and eotaxin-3 with high affinity. CCR3 has also been reported to bind RANTES, MCP-3, and MCP-4 with low affinity. CCR3 receptor is expressed on human eosinophils, basophils, mast cells, mononuclear phagocytes, platelets, CD34+ hematopoietic progenitor cells, Th2-like lymphocytes, and keratinocytes. CCR3 is thought to play a role in allergic diseases such as bronchial asthma and allergic rhinitis. CCR3 is a co-receptor for HIV-1 and HIV-2, and the binding of eotaxin with CCR3 has been shown to inhibit HIV infection in some cell types.
Product DetailsProduct Details
- Verified Reactivity
- Human
- Antibody Type
- Monoclonal
- Host Species
- Mouse
- Formulation
- Phosphate-buffered solution, pH 7.2, containing 0.09% sodium azide and EDTA
- Preparation
- The antibody was purified by chromatography and conjugated with TotalSeq™-D oligomer under optimal conditions.
- Concentration
- 0.5 mg/mL
- Storage & Handling
- The antibody solution should be stored undiluted between 2°C and 8°C. Do not freeze.
- Application
-
PG - Quality tested
- Recommended Usage
-
Each lot of this antibody is quality control tested by immunofluorescent staining with flow cytometric analysis and the oligomer sequence is confirmed by sequencing. TotalSeq™-D antibodies are compatible with Mission Bio’s Tapestri Single-Cell Sequencing Platform for simultaneous detection of DNA and Protein.
To maximize performance, it is strongly recommended that the reagent be titrated for each application, and that you centrifuge the antibody dilution before adding to the cells at 14,000xg at 2 - 8°C for 10 minutes. Carefully pipette out the liquid avoiding the bottom of the tube and add to the cell suspension. For Proteogenomics analysis, the suggested starting amount of this reagent for titration is ≤ 1.0 µg per million cells in 100 µL volume. Refer to the corresponding TotalSeq™ protocol for specific staining instructions.
Buyer is solely responsible for determining whether Buyer has all intellectual property rights that are necessary for Buyer's intended uses of the BioLegend TotalSeq™ products. For example, for any technology platform Buyer uses with TotalSeq™, it is Buyer's sole responsibility to determine whether it has all necessary third party intellectual property rights to use that platform and TotalSeq™ with that platform. - Application Notes
-
Additional reported applications (for the relevant formats) include: The 5E8 antibody is useful for immunofluorescent staining and flow cytometric analysis of CCR3 expression.
It has been observed that the 5E8 antibody clone can interact with PE/Cyanine7 antibody conjugates during multi-color staining, potentially leading to unwanted staining. This interaction can be resolved by sequentially staining with the 5E8 antibody first and then followed by the PE/Cyanine7 conjugate of interest. - Additional Product Notes
-
TotalSeq™-D reagents are designed to profile protein expression at single cell level. The Mission Bio Tapestri platform and sequencer (e.g. Illumina analyzers) are required. Please contact technical support for more information, or visit biolegend.com/totalseq/single-cell-dna
The barcode flanking sequences are CGAGATGACTACGCTACTCATGG (PCR handle), and GAGCCGATCTAGTATCTCAGT*C*G (capture sequence). * indicates a phosphorothioated bond, to prevent nuclease degradation.
View more applications data for this product in our Application Technical Notes. -
Application References
(PubMed link indicates BioLegend citation) -
- Beauvillian C, et al. 2011. Blood 117:1196. PubMed
- RRID
-
AB_2904338 (BioLegend Cat. No. 310735)
Antigen Details
- Structure
- G-protein coupled seven transmembrane domain receptor, 356 amino acids
- Distribution
-
Eosinophils, basophils, mast, mononuclear phagocytes, platelets, CD34+ hematopoietic progenitor, Th2, keratinocytes
- Function
- Co-receptor for HIV-1 and HIV-2, allergy
- Receptors
- Eotaxin, eotaxin-2, eotaxin-3
- Cell Type
- Eosinophils, Erythrocytes, Hematopoietic stem and progenitors, Macrophages, Mast cells, Thymocytes
- Biology Area
- Immunology
- Molecular Family
- CD Molecules, Cytokine/Chemokine Receptors, GPCR
- Antigen References
-
1. Gerard W, et al. 1996. J. Exp. Med. 183:2437.
2. Uguccioni C, et al. 1997. J. Clin. Invest. 100:1137.
3. Sallusto F, et al. 1997. Science. 277:2005.
4. Loetscher P, et al. 2001. J. Biol. Chem. 276:2986. - Regulation
- Upregulated by high affinity Fc IgE receptor ligation (mast cells), RANTES (keratinocytes), IFNg (monocytes, neutrophils), HIV tat protein (basophils), IL-3, IL-5 and GM-CSF (CD34+ progenitor cells), IL-2 and IL-4(T cells). Downregulated by IL-
- Gene ID
- 1232 View all products for this Gene ID
- UniProt
- View information about CD193 on UniProt.org
Related FAQs
- Does staining at room temperature or even at 37°C help for checking chemokine receptors expression?
-
Due to continuous recycling of many chemokine receptors, it may be worthwhile to consider staining at room temperature or at 37°C if the staining at lower temperature (which can potentially reduce receptor turnover) is not optimal.
Other Formats
View All CD193 Reagents Request Custom ConjugationCompare Data Across All Formats
This data display is provided for general comparisons between formats.
Your actual data may vary due to variations in samples, target cells, instruments and their settings, staining conditions, and other factors.
If you need assistance with selecting the best format contact our expert technical support team.
-
Purified anti-human CD193 (CCR3)
-
PE anti-human CD193 (CCR3)
-
Brilliant Violet 605™ anti-human CD193 (CCR3)
-
APC anti-human CD193 (CCR3)
-
Alexa Fluor® 647 anti-human CD193 (CCR3)
-
APC/Cyanine7 anti-human CD193 (CCR3)
-
Brilliant Violet 421™ anti-human CD193 (CCR3)
-
PerCP/Cyanine5.5 anti-human CD193 (CCR3)
-
FITC anti-human CD193 (CCR3)
-
Brilliant Violet 510™ anti-human CD193 (CCR3)
-
Biotin anti-human CD193 (CCR3)
-
APC/Fire™ 750 anti-human CD193 (CCR3)
-
PE/Dazzle™ 594 anti-human CD193 (CCR3)
-
TotalSeq™-A0397 anti-human CD193 (CCR3)
-
TotalSeq™-C0397 anti-human CD193 (CCR3)
-
Brilliant Violet 711™ anti-human CD193 (CCR3) Antibody
-
TotalSeq™-D0397 anti-human CD193 (CCR3)
-
TotalSeq™-B0397 anti-human CD193 (CCR3)
-
Spark Blue™ 550 anti-human CD193 (CCR3) (Flexi-Fluor™)
-
Spark Red™ 718 anti-human CD193 (CCR3) (Flexi-Fluor™)
Follow Us