IMPORTANT NOTICE: Our email addresses will soon change. Learn more >>

TotalSeq™-D0136 anti-human IgM Antibody

Pricing & Availability
Clone
MHM-88 (See other available formats)
Regulatory Status
RUO
Other Names
Immunoglobulin M
Isotype
Mouse IgG1, κ
Barcode Sequence
TAGCGAGCCCGTATA
Ave. Rating
Submit a Review
Cat # Size Price Quantity Check Availability Save
314553 10 µg 296€
Check Availability


Need larger quantities of this item?
Request Bulk Quote
Description

IgM is the first immunoglobulin made by B cells in the immune response. Surface IgM is expressed on immature and mature B cells, while IgM heavy (μ) chain is expressed intracellularly in pre-B cells.

Product Details
Technical Data Sheet (pdf)

Product Details

Verified Reactivity
Human
Reported Reactivity
African Green, Baboon, Cynomolgus, Rhesus
Antibody Type
Monoclonal
Host Species
Mouse
Immunogen
Human Ig cocktail
Formulation
Phosphate-buffered solution, pH 7.2, containing 0.09% sodium azide and EDTA
Preparation
The antibody was purified by chromatography and conjugated with TotalSeq™-D oligomer under optimal conditions.
Concentration
0.5 mg/mL
Storage & Handling
The antibody solution should be stored undiluted between 2°C and 8°C. Do not freeze.
Application

PG - Quality tested

Recommended Usage

Each lot of this antibody is quality control tested by immunofluorescent staining with flow cytometric analysis and the oligomer sequence is confirmed by sequencing. TotalSeq™-D antibodies are compatible with Mission Bio’s Tapestri Single-Cell Sequencing Platform for simultaneous detection of DNA and Protein.

To maximize performance, it is strongly recommended that the reagent be titrated for each application, and that you centrifuge the antibody dilution before adding to the cells at 14,000xg at 2 - 8°C for 10 minutes. Carefully pipette out the liquid avoiding the bottom of the tube and add to the cell suspension. For Proteogenomics analysis, the suggested starting amount of this reagent for titration is ≤ 1.0 µg per million cells in 100 µL volume. Refer to the corresponding TotalSeq™ protocol for specific staining instructions.


Buyer is solely responsible for determining whether Buyer has all intellectual property rights that are necessary for Buyer's intended uses of the BioLegend TotalSeq™ products. For example, for any technology platform Buyer uses with TotalSeq™, it is Buyer's sole responsibility to determine whether it has all necessary third party intellectual property rights to use that platform and TotalSeq™ with that platform.
Application Notes

MHM-88 antibody reacts with both soluble and membrane human immunoglobulin M (IgM). It does not react with other Ig isotypes. Additional reported applications (for the relevant formats) include: use as a primary or secondary reagent for ELISA analysis.

Due to the presence of excess soluble IgM in whole blood, which competes for antibody binding, staining for IgM on cells in whole blood is not recommended.

Additional Product Notes

TotalSeq™-D reagents are designed to profile protein expression at single cell level. The Mission Bio Tapestri platform and sequencer (e.g. Illumina analyzers) are required. Please contact technical support for more information, or visit biolegend.com/totalseq/single-cell-dna

The barcode flanking sequences are CGAGATGACTACGCTACTCATGG (PCR handle), and GAGCCGATCTAGTATCTCAGT*C*G (capture sequence). * indicates a phosphorothioated bond, to prevent nuclease degradation.

View more applications data for this product in our Application Technical Notes.

Application References
  1. Perez-Shiyama C, et al. 2014. J Immunol. 192:5192. PubMed
RRID
AB_2922547 (BioLegend Cat. No. 314553)

Antigen Details

Structure
Ig family
Distribution

B cells

Function
B cell differentiation, humoral immune response; cross-linking surface IgM induces apoptosis
Cell Type
B cells
Biology Area
Immunology
Gene ID
3507 View all products for this Gene ID
UniProt
View information about IgM on UniProt.org

Related FAQs

There are no FAQs for this product.

Other Formats

View All IgM Reagents Request Custom Conjugation
Description Clone Applications
Purified anti-human IgM MHM-88 FC,ELISA
PE anti-human IgM MHM-88 FC
Biotin anti-human IgM MHM-88 FC,ELISA
FITC anti-human IgM MHM-88 FC
APC anti-human IgM MHM-88 FC
PerCP/Cyanine5.5 anti-human IgM MHM-88 FC
Pacific Blue™ anti-human IgM MHM-88 FC
Brilliant Violet 421™ anti-human IgM MHM-88 FC
APC/Cyanine7 anti-human IgM MHM-88 FC
Brilliant Violet 570™ anti-human IgM MHM-88 FC
Brilliant Violet 510™ anti-human IgM MHM-88 FC
Brilliant Violet 605™ anti-human IgM MHM-88 FC
Brilliant Violet 650™ anti-human IgM MHM-88 FC
Purified anti-human IgM (Maxpar® Ready) MHM-88 FC,CyTOF®
PE/Dazzle™ 594 anti-human IgM MHM-88 FC
PE/Cyanine7 anti-human IgM MHM-88 FC
Alexa Fluor® 488 anti-human IgM MHM-88 FC
Alexa Fluor® 647 anti-human IgM MHM-88 FC
Alexa Fluor® 700 anti-human IgM MHM-88 FC
Brilliant Violet 711™ anti-human IgM MHM-88 FC
TotalSeq™-A0136 anti-human IgM MHM-88 PG
TotalSeq™-C0136 anti-human IgM MHM-88 PG
Brilliant Violet 785™ anti-human IgM MHM-88 FC
APC/Fire™ 750 anti-human IgM MHM-88 FC
TotalSeq™-B0136 anti-human IgM MHM-88 PG
Spark Violet™ 423 anti-human IgM Antibody MHM-88 FC
TotalSeq™-D0136 anti-human IgM MHM-88 PG
Spark Blue™ 550 anti-human IgM MHM-88 FC
Spark Blue™ 515 anti-human IgM MHM-88 FC
PE/Fire™ 700 anti-human IgM MHM-88 FC
Spark YG™ 593 anti-human IgM MHM-88 FC
PE/Fire™ 640 anti-human IgM MHM-88 FC
Spark Red™ 718 anti-human IgM (Flexi-Fluor™) MHM-88 FC
APC anti-human IgM MHM-88 FC
PE anti-human IgM MHM-88 FC
Brilliant Violet 750™ anti-human IgM MHM-88 FC
FITC anti-human IgM MHM-88 FC
Spark PLUS UV395™ anti-human IgM Antibody MHM-88 FC
Go To Top Version: 1    Revision Date: 03/18/2022

For Research Use Only. Not for diagnostic or therapeutic use.

 

This product is supplied subject to the terms and conditions, including the limited license, located at www.biolegend.com/terms) ("Terms") and may be used only as provided in the Terms. Without limiting the foregoing, BioLegend products may not be used for any Commercial Purpose as defined in the Terms, resold in any form, used in manufacturing, or reverse engineered, sequenced, or otherwise studied or used to learn its design or composition without express written approval of BioLegend. Regardless of the information given in this document, user is solely responsible for determining any license requirements necessary for user’s intended use and assumes all risk and liability arising from use of the product. BioLegend is not responsible for patent infringement or any other risks or liabilities whatsoever resulting from the use of its products.

 

BioLegend, the BioLegend logo, and all other trademarks are property of BioLegend, Inc. or their respective owners, and all rights are reserved.

 

8999 BioLegend Way, San Diego, CA 92121 www.biolegend.com
Toll-Free Phone: 1-877-Bio-Legend (246-5343) Phone: (858) 768-5800 Fax: (877) 455-9587

This data display is provided for general comparisons between formats.
Your actual data may vary due to variations in samples, target cells, instruments and their settings, staining conditions, and other factors.
If you need assistance with selecting the best format contact our expert technical support team.


Login / Register
Remember me
Forgot your password? Reset password?
Create an Account