- Clone
- A019D5 (See other available formats)
- Regulatory Status
- RUO
- Other Names
- IL-7 receptor α chain, IL-7Rα
- Isotype
- Mouse IgG1, κ
- Barcode Sequence
- GTGTGTTGTCCTATG
- Ave. Rating
- Submit a Review
- Product Citations
- publications
Cat # | Size | Price | Quantity Check Availability | Save | ||
---|---|---|---|---|---|---|
351371 | 10 µg | 296€ |
CD127 is a 60-90 kD type I transmembrane glycoprotein also known as IL-7 receptor α chain or IL-7Rα. It forms a heterodimer with the common γ chain (γc or CD132) which is shared with the receptors for IL-2, IL-4, IL-9, IL-13, IL-15, and IL-21. CD127 is expressed on immature B cells through early pre-B stage cells, thymocytes (except CD4/CD8 double positive thymocytes), peripheral T cells, and bone marrow stromal cells. CD127 has been reported to be a useful marker for identifying memory and effector T cells. Studies have shown that CD127 expression is down-modulated on Treg cells. It can be used as a marker for differentiation of Treg and conventional T cells. The ligation of IL-7 with its receptor is important for stimulation of mature and immature T cells as well as immature B cell proliferation and development.
Product DetailsProduct Details
- Verified Reactivity
- Human
- Reported Reactivity
- African Green, Baboon, Cynomolgus, Rhesus
- Antibody Type
- Monoclonal
- Host Species
- Mouse
- Immunogen
- Recombinant human CD127
- Formulation
- Phosphate-buffered solution, pH 7.2, containing 0.09% sodium azide and EDTA
- Preparation
- The antibody was purified by chromatography and conjugated with TotalSeq™-D oligomer under optimal conditions.
- Concentration
- 0.5 mg/mL
- Storage & Handling
- The antibody solution should be stored undiluted between 2°C and 8°C. Do not freeze.
- Application
-
PG - Quality tested
- Recommended Usage
-
Each lot of this antibody is quality control tested by immunofluorescent staining with flow cytometric analysis and the oligomer sequence is confirmed by sequencing. TotalSeq™-D antibodies are compatible with Mission Bio’s Tapestri Single-Cell Sequencing Platform for simultaneous detection of DNA and Protein.
To maximize performance, it is strongly recommended that the reagent be titrated for each application, and that you centrifuge the antibody dilution before adding to the cells at 14,000xg at 2 - 8°C for 10 minutes. Carefully pipette out the liquid avoiding the bottom of the tube and add to the cell suspension. For Proteogenomics analysis, the suggested starting amount of this reagent for titration is ≤ 1.0 µg per million cells in 100 µL volume. Refer to the corresponding TotalSeq™ protocol for specific staining instructions.
Buyer is solely responsible for determining whether Buyer has all intellectual property rights that are necessary for Buyer's intended uses of the BioLegend TotalSeq™ products. For example, for any technology platform Buyer uses with TotalSeq™, it is Buyer's sole responsibility to determine whether it has all necessary third party intellectual property rights to use that platform and TotalSeq™ with that platform. - Application Notes
-
Additional reported (for the relevant formats) application: proteogenomics1.
- Additional Product Notes
-
TotalSeq™-D reagents are designed to profile protein expression at single cell level. The Mission Bio Tapestri platform and sequencer (e.g. Illumina analyzers) are required. Please contact technical support for more information, or visit biolegend.com/totalseq/single-cell-dna
The barcode flanking sequences are CGAGATGACTACGCTACTCATGG (PCR handle), and GAGCCGATCTAGTATCTCAGT*C*G (capture sequence). * indicates a phosphorothioated bond, to prevent nuclease degradation.
View more applications data for this product in our Application Technical Notes. - Application References
-
- Peterson VM, et al. 2017. Nat. Biotechnol. 35:936. (PG)
- RRID
-
AB_2892428 (BioLegend Cat. No. 351371)
Antigen Details
- Structure
- Type I transmembrane glycoprotein, associates with CD132, 60-90 kD
- Distribution
-
Immature B cells through early pre-B stage, thymocytes (except CD4/CD8 double positive thymocytes), peripheral T cells, bone marrow stromal cells
- Function
- T cell and immature B cell proliferation and development
- Ligand/Receptor
- IL-7
- Cell Type
- B cells, T cells, Thymocytes, Tregs
- Biology Area
- Immunology
- Molecular Family
- CD Molecules, Cytokine/Chemokine Receptors
- Antigen References
-
1. Sudo T, et al. 1993. P. Natl. Acad. Sci. USA 90:9125.
2. He YW and Malek TR. 1998. Crit. Rev. Immunol. 18:503.
3. Huster KM, et al. 2004. P. Natl. Acad. Sci. USA 101:5610.
4. Pillai M, et al. 2004. Leukemia Lymphoma 45:2403.
5. Morrissey PJ, et al. 1989. J. Exp. Med. 169:707.
6. Liu W, et al. 2006. J. Exp. Med. 203:1701. - Gene ID
- 3575 View all products for this Gene ID
- UniProt
- View information about CD127 on UniProt.org
Related FAQs
Other Formats
View All CD127 Reagents Request Custom ConjugationCompare Data Across All Formats
This data display is provided for general comparisons between formats.
Your actual data may vary due to variations in samples, target cells, instruments and their settings, staining conditions, and other factors.
If you need assistance with selecting the best format contact our expert technical support team.
-
Purified anti-human CD127 (IL-7Rα)
Human peripheral blood lymphocytes were stained with purifie... -
PE anti-human CD127 (IL-7Rα)
Human peripheral blood lymphocytes were stained with CD3 APC... -
Pacific Blue™ anti-human CD127 (IL-7Rα)
Human peripheral blood lymphocytes were stained with CD3 PE ... -
Brilliant Violet 421™ anti-human CD127 (IL-7Rα)
Human peripheral blood lymphocytes were stained with CD3 FIT... -
FITC anti-human CD127 (IL-7Rα)
Human peripheral blood lymphocytes were stained with CD3 APC... -
Alexa Fluor® 488 anti-human CD127 (IL-7Rα)
Human peripheral blood lymphocytes were stained with CD3 APC... -
APC anti-human CD127 (IL-7Rα)
Human peripheral blood lymphocytes were stained with CD3 FIT... -
Alexa Fluor® 647 anti-human CD127 (IL-7Rα)
Human peripheral blood lymphocytes were stained with CD3 FIT... -
PE/Cyanine7 anti-human CD127 (IL-7Rα)
Human peripheral blood lymphocytes were stained with CD3 FIT... -
PerCP/Cyanine5.5 anti-human CD127 (IL-7Rα)
Human peripheral blood lymphocytes were stained with CD3 FIT... -
Brilliant Violet 570™ anti-human CD127 (IL-7Rα)
Human peripheral blood lymphocytes were stained with CD3 FIT... -
PE/Cyanine5 anti-human CD127 (IL-7Rα)
Human peripheral blood lymphocytes were stained with CD3 FIT... -
Brilliant Violet 650™ anti-human CD127 (IL-7Rα)
Human peripheral blood lymphocytes were stained with CD3 FIT... -
Brilliant Violet 711™ anti-human CD127 (IL-7Rα)
Human peripheral blood lymphocytes were stained with CD127 (... -
Brilliant Violet 785™ anti-human CD127 (IL-7Rα)
Human peripheral blood lymphocytes were stained with CD127 (... -
Brilliant Violet 510™ anti-human CD127 (IL-7Rα)
Human peripheral blood lymphocytes were stained with CD127 (... -
Brilliant Violet 605™ anti-human CD127 (IL-7Rα)
Human peripheral blood lymphocytes were stained with CD3 FIT... -
PE/Dazzle™ 594 anti-human CD127 (IL-7Rα)
Human peripheral blood lymphocytes were stained with CD3 FIT... -
Purified anti-human CD127 (IL-7Rα) (Maxpar® Ready)
Human PBMCs stained with 154Sm-anti-CD3 (UCHT1) and 143Nd-an... -
Alexa Fluor® 700 anti-human CD127 (IL-7Rα)
Human peripheral blood lymphocytes were stained with CD3 PE ... -
Biotin anti-human CD127 (IL-7Rα)
Human peripheral blood lymphocytes were stained with CD3 APC... -
APC/Cyanine7 anti-human CD127 (IL-7Rα)
Human peripheral blood lymphocytes were stained with CD3 FIT... -
APC/Fire™ 750 anti-human CD127 (IL-7Rα)
Human peripheral blood lymphocytes were stained with CD3 FIT... -
TotalSeq™-A0390 anti-human CD127 (IL-7Rα)
-
TotalSeq™-B0390 anti-human CD127 (IL-7Rα)
-
TotalSeq™-C0390 anti-human CD127 (IL-7Rα)
-
KIRAVIA Blue 520™ anti-human CD127 (IL-7Rα)
Human peripheral blood lymphocytes were stained with CD3 APC... -
Spark NIR™ 685 anti-human CD127 (IL-7Rα)
Human peripheral blood lymphocytes stained with CD3 FITC and... -
PE/Fire™ 640 anti-human CD127 (IL-7Rα)
Human peripheral blood lymphocytes were stained with anti-hu... -
PE/Fire™ 700 anti-human CD127 (IL-7Rα) Antibody
Human peripheral blood lymphocytes were stained with anti-hu... -
Spark YG™ 581 anti-human CD127 (IL-7Rα)
Human peripheral blood lymphocytes were stained with anti-hu... -
Brilliant Violet 750™ anti-human CD127 (IL-7Rα)
Human peripheral blood lymphocytes were stained with anti-hu... -
TotalSeq™-D0390 anti-human CD127 (IL-7Rα)
-
APC/Fire™ 810 anti-human CD127 (IL-7Rα) Antibody
Human peripheral blood lymphocytes were stained with anti-hu... -
APC/Fire™ 750 anti-human CD127
Typical results from human peripheral blood lymphocytes stai... -
PE anti-human CD127
Typical results from human peripheral blood lymphocytes stai... -
PerCP/Cyanine5.5 anti-human CD127
Typical results from human peripheral blood lymphocytes stai... -
PE/Cyanine7 anti-human CD127
Typical results from human peripheral blood lymphocytes stai... -
Spark Red™ 718 anti-human CD127 (IL-7Rα)
Human peripheral blood lymphocytes were stained with anti-hu... -
GMP PE/Cyanine7 anti-human CD127 (IL-7Rα)
Typical results from human peripheral blood lymphocytes stai... -
PE/Fire™ 744 anti-human CD127 (IL-7Rα)
Human peripheral blood lymphocytes were stained with anti-hu... -
PerCP/Fire™ 780 anti-human CD127 (IL-7Rα)
Human peripheral blood lymphocytes were stained with anti-hu... -
PerCP/Fire™ 806 anti-human CD127 (IL-7Rα)
Human peripheral blood lymphocytes were stained with anti-hu... -
Spark PLUS B550™ anti-human CD127 (IL-7Rα)
Human peripheral blood lymphocytes were stained with anti-hu... -
GMP PerCP/Cyanine5.5 anti-human CD127 (IL-7Rα)
Typical results from human peripheral blood lymphocytes stai... -
GMP PE anti-human CD127 (IL-7Rα)
Typical results from human peripheral blood lymphocytes stai... -
GMP APC/Fire™ 750 anti-human CD127 (IL-7Rα)
Typical results from human peripheral blood lymphocytes stai...
Follow Us