TotalSeq™-D0032 anti-human CD154 antibody, CD154, 24-31

Pricing & Availability

Clone: 24-31 (See other available formats)
Regulatory Status: RUO
Other Names: CD40L, gp39, TRAP, T-BAM, TNFSF5
Isotype: Mouse IgG1, κ
Barcode Sequence: GCTAGATAGATGCAA
Ave. Rating: Submit a Review
Product Citations: publications

Compare all formats

Cat #

Size

Price

Quantity Check Availability

Save

310853

10 µg

$369

Check Availability

Need larger quantities of this item?
Request Bulk Quote

Description

CD154 (CD40 ligand) is also known as CD40L, gp39, TRAP and T-BAM. CD40 ligand is a 32-39 kD type II transmembrane glycoprotein. It is a member of the TNF superfamily and is expressed on activated T cells. It has been reported to be important for B cell costimulation following binding of its receptor, CD40. Additionally, binding of CD40L to CD40 on B cells promotes the secretion of immunoglobulin and Ig isotype switching. CD40L is also involved in the regulation of cytokine production by T cells.

Product Details

Technical data sheet

Product Details

Verified Reactivity: Human
Reported Reactivity: Cynomolgus, Rhesus
Antibody Type: Monoclonal
Host Species: Mouse
Formulation: Phosphate-buffered solution, pH 7.2, containing 0.09% sodium azide and EDTA
Preparation: The antibody was purified by chromatography and conjugated with TotalSeq™-D oligomer under optimal conditions.
Concentration: 0.5 mg/mL
Storage & Handling: The antibody solution should be stored undiluted between 2°C and 8°C. Do not freeze.
Application: PG - Quality tested
Recommended Usage: Each lot of this antibody is quality control tested by immunofluorescent staining with flow cytometric analysis and the oligomer sequence is confirmed by sequencing. TotalSeq™-D antibodies are compatible with Mission Bio’s Tapestri Single-Cell Sequencing Platform for simultaneous detection of DNA and Protein.

To maximize performance, it is strongly recommended that the reagent be titrated for each application, and that you centrifuge the antibody dilution before adding to the cells at 14,000xg at 2 - 8°C for 10 minutes. Carefully pipette out the liquid avoiding the bottom of the tube and add to the cell suspension. For Proteogenomics analysis, the suggested starting amount of this reagent for titration is ≤ 1.0 µg per million cells in 100 µL volume. Refer to the corresponding TotalSeq™ protocol for specific staining instructions.

Buyer is solely responsible for determining whether Buyer has all intellectual property rights that are necessary for Buyer's intended uses of the BioLegend TotalSeq™ products. For example, for any technology platform Buyer uses with TotalSeq™, it is Buyer's sole responsibility to determine whether it has all necessary third party intellectual property rights to use that platform and TotalSeq™ with that platform.
Application Notes: Additional reported applications (for the relevant formats) include: immunofluorescence microscopy^1,3 and blocking of T cell-dependent B cell differentiation^1,2,4,5. The LEAF™ purified antibody (Endotoxin <0.1 EU/µg, Azide-Free, 0.2 µm filtered) is recommended for functional assays (Cat. No. 310812). For highly sensitive assays, we recommend Ultra-LEAF™ purified antibody (Cat. No. 310828) with a lower endotoxin limit than standard LEAF™ purified antibodies (Endotoxin <0.01 EU/µg).
Additional Product Notes: TotalSeq™-D reagents are designed to profile protein expression at single cell level. The Mission Bio Tapestri platform and sequencer (e.g. Illumina analyzers) are required. Please contact technical support for more information, or visit biolegend.com/totalseq/single-cell-dna

The barcode flanking sequences are CGAGATGACTACGCTACTCATGG (PCR handle), and GAGCCGATCTAGTATCTCAGT*C*G (capture sequence). * indicates a phosphorothioated bond, to prevent nuclease degradation.

View more applications data for this product in our Application Technical Notes.
RRID: AB_2894564 (BioLegend Cat. No. 310853)

Antigen Details

Structure: TNF superfamily, type II transmembrane glycoprotein, cleaved as soluble CD40L, 32-39 kD
Distribution: Activated T cells
Function: B cell costimulation
Ligand/Receptor: CD40
Cell Type: T cells, Tregs
Biology Area: Costimulatory Molecules, Immunology
Molecular Family: CD Molecules
Antigen References: 1. Najafian N, et al. 2003. Expert Opin. Biol. Ther. 3:227.
2. Racke M, et al. 2002. Expert Opin. Ther. Targets. 6:275.
3. Ford G, et al. 1999. J. Immunol. 162:4037.
Gene ID: 959 View all products for this Gene ID
UniProt: View information about CD154 on UniProt.org

Documentation

Reviews

Review This Product

Related Protocols

TotalSeq™-D with Mission Bio Tapestri® Single-Cell DNA + Protein Protocol

Related Products

Description	Clone	Applications

Related Pages & Pathways

Pathways

Related FAQs

Other Formats

View All CD154 Reagents Request Custom Conjugation

Description	Clone	Applications
Purified anti-human CD154	24-31	FC,IHC-F
FITC anti-human CD154	24-31	FC,IHC-F
PE anti-human CD154	24-31	FC
PE/Cyanine5 anti-human CD154	24-31	FC
APC anti-human CD154	24-31	FC
Biotin anti-human CD154	24-31	FC,IHC-F
Alexa Fluor® 488 anti-human CD154	24-31	FC,IHC-F
Alexa Fluor® 647 anti-human CD154	24-31	FC,IHC-F
Pacific Blue™ anti-human CD154	24-31	FC
Brilliant Violet 785™ anti-human CD154	24-31	FC
APC/Cyanine7 anti-human CD154	24-31	FC
Brilliant Violet 421™ anti-human CD154	24-31	FC,IHC-F
Brilliant Violet 605™ anti-human CD154	24-31	FC
Ultra-LEAF™ Purified anti-human CD154	24-31	FC,Block,IHC-F
Brilliant Violet 510™ anti-human CD154	24-31	FC,IHC-F
PE/Cyanine7 anti-human CD154	24-31	FC
PerCP/Cyanine5.5 anti-human CD154	24-31	FC
Brilliant Violet 711™ anti-human CD154	24-31	FC
Purified anti-human CD154 (Maxpar® Ready)	24-31	FC,CyTOF®
PE/Dazzle™ 594 anti-human CD154	24-31	FC
TotalSeq™-A0032 anti-human CD154	24-31	PG
Alexa Fluor® 700 anti-human CD154	24-31	FC
APC/Fire™ 750 anti-human CD154	24-31	FC
TotalSeq™-C0032 anti-human CD154	24-31	PG
TotalSeq™-B0032 anti-human CD154	24-31	PG
TotalSeq™-D0032 anti-human CD154	24-31	PG
PE/Fire™ 640 anti-human CD154	24-31	FC
PE/Fire™ 810 anti-human CD154	24-31	FC
PerCP/Fire™ 780 anti-human CD154	24-31	FC
PE/Fire™ 700 anti-human CD154	24-31	FC
Spark Red™ 718 anti-human CD154 (Flexi-Fluor™)	24-31	FC
Brilliant Violet 650™ anti-human CD154	24-31	FC
Spark Blue™ 574 anti-human CD154 (Flexi-Fluor™)	24-31	FC
Spark Blue™ 550 anti-human CD154 (Flexi-Fluor™)	24-31	FC

Certificate of Analysis

Go To Top Version: 1 Revision Date: 08/04/2021

For Research Use Only. Not for diagnostic or therapeutic use.

This product is supplied subject to the terms and conditions, including the limited license, located at www.biolegend.com/terms) ("Terms") and may be used only as provided in the Terms. Without limiting the foregoing, BioLegend products may not be used for any Commercial Purpose as defined in the Terms, resold in any form, used in manufacturing, or reverse engineered, sequenced, or otherwise studied or used to learn its design or composition without express written approval of BioLegend. Regardless of the information given in this document, user is solely responsible for determining any license requirements necessary for user’s intended use and assumes all risk and liability arising from use of the product. BioLegend is not responsible for patent infringement or any other risks or liabilities whatsoever resulting from the use of its products.

BioLegend, the BioLegend logo, and all other trademarks are property of BioLegend, Inc. or their respective owners, and all rights are reserved.

8999 BioLegend Way, San Diego, CA 92121 www.biolegend.com
Toll-Free Phone: 1-877-Bio-Legend (246-5343) Phone: (858) 768-5800 Fax: (877) 455-9587

This data display is provided for general comparisons between formats.
Your actual data may vary due to variations in samples, target cells, instruments and their settings, staining conditions, and other factors.
If you need assistance with selecting the best format contact our expert technical support team.