TotalSeq™-D0159 anti-human HLA-DR Antibody

Pricing & Availability
Clone
L243 (See other available formats)
Regulatory Status
RUO
Other Names
Major Histocompatibility Class II, MHC class II
Isotype
Mouse IgG2a, κ
Barcode Sequence
AATAGCGAGCAAGTA
Ave. Rating
Submit a Review
Product Citations
publications
Cat # Size Price Quantity Check Availability Save
307681 10 µg $369
Check Availability


Need larger quantities of this item?
Request Bulk Quote
Description

HLA-DR is a heterodimeric cell surface glycoprotein comprised of a 36 kD α (heavy) chain and a 27 kD β (light) chain. It is expressed on B cells, activated T cells, monocytes/macrophages, dendritic cells, and other non-professional APCs. In conjunction with the CD3/TCR complex and CD4 molecules, HLA-DR is critical for efficient peptide presentation to CD4+ T cells.

Product Details
Technical data sheet

Product Details

Verified Reactivity
Human, Cynomolgus, Rhesus
Reported Reactivity
African Green, Baboon, Chimpanzee, Dog, Common Marmoset, Squirrel Monkey, Cotton-topped Tamarin
Antibody Type
Monoclonal
Host Species
Mouse
Formulation
Phosphate-buffered solution, pH 7.2, containing 0.09% sodium azide and EDTA
Preparation
The antibody was purified by chromatography and conjugated with TotalSeq™-D oligomer under optimal conditions.
Concentration
0.5 mg/mL
Storage & Handling
The antibody solution should be stored undiluted between 2°C and 8°C. Do not freeze.
Application

PG - Quality tested

Recommended Usage

Each lot of this antibody is quality control tested by immunofluorescent staining with flow cytometric analysis and the oligomer sequence is confirmed by sequencing. TotalSeq™-D antibodies are compatible with Mission Bio’s Tapestri Single-Cell Sequencing Platform for simultaneous detection of DNA and Protein.

To maximize performance, it is strongly recommended that the reagent be titrated for each application, and that you centrifuge the antibody dilution before adding to the cells at 14,000xg at 2 - 8°C for 10 minutes. Carefully pipette out the liquid avoiding the bottom of the tube and add to the cell suspension. For Proteogenomics analysis, the suggested starting amount of this reagent for titration is ≤ 1.0 µg per million cells in 100 µL volume. Refer to the corresponding TotalSeq™ protocol for specific staining instructions.


Buyer is solely responsible for determining whether Buyer has all intellectual property rights that are necessary for Buyer's intended uses of the BioLegend TotalSeq™ products. For example, for any technology platform Buyer uses with TotalSeq™, it is Buyer's sole responsibility to determine whether it has all necessary third party intellectual property rights to use that platform and TotalSeq™ with that platform.
Application Notes

The L243 monoclonal antibody reacts with the HLA-DR antigen, a member of MHC class II molecules. It does not cross react with HLA-DP and HLA-DQ. Clone L243 binds a conformational epitope on HLA-DRa which depends on the correct folding of the aß heterodimer.19

Additional reported applications (for the relevant formats) include: immunoprecipitation8, Western blotting8, in vitro blocking of mixed lymphocyte reactions9,10, depeletion of MHC class II cells7, immunohistochemical staining of acetone-fixed frozen sections4,5, and spatial biology (IBEX)21,22. For sensitive functional assays, we recommend using the Ultra-LEAF™ purified antibody (Endotoxin < 0.01 EU/µg, Azide-Free, 0.2 µm filtered) (Cat. No. 307648, 307665 - 307669).

Additional Product Notes

TotalSeq™-D reagents are designed to profile protein expression at single cell level. The Mission Bio Tapestri platform and sequencer (e.g. Illumina analyzers) are required. Please contact technical support for more information, or visit biolegend.com/totalseq/single-cell-dna

The barcode flanking sequences are CGAGATGACTACGCTACTCATGG (PCR handle), and GAGCCGATCTAGTATCTCAGT*C*G (capture sequence). * indicates a phosphorothioated bond, to prevent nuclease degradation.

View more applications data for this product in our Application Technical Notes.

Application References

(PubMed link indicates BioLegend citation)
  1. Brodsky F. 1984. Immunogenetics 19:179.
  2. Robbins P, et al. 1987. Human Immunol. 18:301.
  3. Stites D, et al. 1986. Clin. Immunol. Immunopathol. 38:161.
  4. Warnke R, et al. 1980. J. Histochem. Cytochem. 28:771. (IHC)
  5. Engleman E, et al. 1981. P. Natl. Acad. Sci. USA 78:1791. (IHC)
  6. Zipf T, et al. 1981. Cancer Res. 41:4786.
  7. Goodier M, et al. 2000. J. Immunol. 165:139. (Depletion)
  8. Esser M, et al. 2001. J. Virol. 75:6173. (IP, WB)
  9. Kalka-Moll WM, et al. 2002. J. Immunol. 169:6149. (Block)
  10. Wang RF, et al. 1999. Science 284:1351. (Block)
  11. Zaba LC, et al. 2007. J. Exp. Med. 204:3183. PubMed
  12. Fujita H, et al. 2009. P. Natl. Acad. Sci. USA 106:21795. PubMed
  13. Charles N, et al. 2010. Nat. Med. 16:701. (FC) PubMed
  14. Goncalves RM, et al. 2010. Infect. Immun. 78:4763. PubMed
  15. Yoshino N, et al. 2000. Exp. Anim. (Tokyo) 49:97. (FC)
  16. Kim WK, et al. 2006. Am. J. Pathol. 168:822. (FC)
  17. Stein R, et al. 2011. Leuk. Lymphoma 52:273.
  18. Galkowska H, et al. 1996. Vet. Immunol. Immunopathol. 53:329.
  19. Moro M, et al. 2005. BMC Immunol. 6:24.
  20. Lauterbach N, et al. 2014. Mol Immunol. 59:19. PubMed
  21. Radtke AJ, et al. 2020. Proc Natl Acad Sci USA. 117:33455-33465. (SB) PubMed
  22. Radtke AJ, et al. 2022. Nat Protoc. 17:378-401. (SB) PubMed
RRID
AB_2892373 (BioLegend Cat. No. 307681)

Antigen Details

Structure
Ig superfamily, MHC class II, heterodimeric transmembrane protein, 36 kD heavy and 27 kD light chain
Distribution

B cells, activated T cells, monocytes/macrophages, dendritic cells, other APCs

Function
Peptide presentation
Ligand/Receptor
CD3/TCR, CD4
Cell Type
Antigen-presenting cells, B cells, Dendritic cells, Macrophages, Monocytes, T cells, Tregs
Biology Area
Immunology, Innate Immunity
Molecular Family
MHC Antigens
Antigen References

1. Levacher M, et al. 1990. Clin. Exp. Immunol. 81:177.
2. Terstappen L, et al. 1990. J. Leukocyte Biol. 48:138.
3. Edwards JA, et al. 1986. J. Immunol. 137:490.
4. van Es A, et al. 1984. Transplantation 37:65.
5. O'Doherty U, et al. 1994. Immunology 82:487.
6. Thomas R, et al. 1994. J. Immunol. 153:4016.
7. Grouard G, et al. 1996. Nature 384:364.

Gene ID
3122 View all products for this Gene ID 3123 View all products for this Gene ID
UniProt
View information about HLA-DR on UniProt.org

Related FAQs

There are no FAQs for this product.

Other Formats

View All HLA-DR Reagents Request Custom Conjugation
Description Clone Applications
APC anti-human HLA-DR L243 FC
FITC anti-human HLA-DR L243 FC
PE anti-human HLA-DR L243 FC
PE/Cyanine5 anti-human HLA-DR L243 FC
Purified anti-human HLA-DR L243 FC,CyTOF®,IP,WB,Block,IHC-F
Biotin anti-human HLA-DR L243 FC
PE/Cyanine7 anti-human HLA-DR L243 FC
APC/Cyanine7 anti-human HLA-DR L243 FC
Alexa Fluor® 488 anti-human HLA-DR L243 FC,SB
Alexa Fluor® 647 anti-human HLA-DR L243 FC
Pacific Blue™ anti-human HLA-DR L243 FC
Alexa Fluor® 700 anti-human HLA-DR L243 FC
PerCP anti-human HLA-DR L243 FC
PerCP/Cyanine5.5 anti-human HLA-DR L243 FC
Brilliant Violet 605™ anti-human HLA-DR L243 FC
Brilliant Violet 421™ anti-human HLA-DR L243 FC
Brilliant Violet 570™ anti-human HLA-DR L243 FC
Brilliant Violet 711™ anti-human HLA-DR L243 FC
Brilliant Violet 785™ anti-human HLA-DR L243 FC
Brilliant Violet 510™ anti-human HLA-DR L243 FC
Ultra-LEAF™ Purified anti-human HLA-DR L243 FC,CyTOF®,IP,WB,Block,IHC-F
Brilliant Violet 650™ anti-human HLA-DR L243 FC
Purified anti-human HLA-DR (Maxpar® Ready) L243 FC,CyTOF®
PE/Dazzle™ 594 anti-human HLA-DR L243 FC
FITC anti-human HLA-DR L243 FC
APC/Fire™ 750 anti-human HLA-DR L243 FC
Pacific Blue™ anti-human HLA-DR L243 FC
APC anti-human HLA-DR L243 FC
PE/Dazzle™ 594 anti-human HLA-DR L243 FC
PE/Cyanine7 anti-human HLA-DR L243 FC
TotalSeq™-A0159 anti-human HLA-DR L243 PG
TotalSeq™-B0159 anti-human HLA-DR L243 PG
TotalSeq™-C0159 anti-human HLA-DR L243 PG
Brilliant Violet 750™ anti-human HLA-DR L243 FC
APC/Fire™ 750 anti-human HLA-DR L243 FC
PerCP/Cyanine5.5 anti-human HLA-DR L243 FC
APC/Fire™ 810 anti-human HLA-DR L243 FC
PE/Fire™ 640 anti-human HLA-DR L243 FC
PE anti-human HLA-DR L243 FC
Spark Violet™ 538 anti-human HLA-DR Antibody L243 FC
KIRAVIA Blue 520™ anti-human HLA-DR L243 FC
TotalSeq™-D0159 anti-human HLA-DR L243 PG
PE/Fire™ 810 anti-human HLA-DR L243 FC
GMP PE/Dazzle™ 594 anti-human HLA-DR L243 FC
Spark Violet™ 423 anti-human HLA-DR L243 FC
PerCP anti-human HLA-DR L243 FC
GMP FITC anti-human HLA-DR L243 FC
GMP APC anti-human HLA-DR L243 FC
GMP PE/Cyanine7 anti-human HLA-DR L243 FC
GMP Pacific Blue™ anti-human HLA-DR L243 FC
GMP APC/Fire™ 750 anti-human HLA-DR L243 FC
Spark Violet™ 500 anti-human HLA-DR L243 FC
GMP PerCP/Cyanine5.5 anti-human HLA-DR L243 FC
GMP PE anti-human HLA-DR L243 FC
Spark UV™ 387 anti-human HLA-DR L243 FC
Spark Blue™ 515 anti-human HLA-DR L243 FC
Spark NIR™ 685 anti-human HLA-DR L243 FC
PerCP/Fire™ 806 anti-human HLA-DR L243 FC
PE/Fire™ 700 anti-human HLA-DR L243 FC
Spark Blue™ 550 anti-human HLA-DR (Flexi-Fluor™) L243 FC
Spark Red™ 718 anti-human HLA-DR (Flexi-Fluor™) L243 FC
PE/Fire™ 744 anti-human HLA-DR L243 FC
Spark PLUS UV395™ anti-human HLA-DR L243 FC
Spark Violet™ 423 anti-human HLA-DR L243 FC
Go To Top Version: 1    Revision Date: 05/24/2021

For Research Use Only. Not for diagnostic or therapeutic use.

 

This product is supplied subject to the terms and conditions, including the limited license, located at www.biolegend.com/terms) ("Terms") and may be used only as provided in the Terms. Without limiting the foregoing, BioLegend products may not be used for any Commercial Purpose as defined in the Terms, resold in any form, used in manufacturing, or reverse engineered, sequenced, or otherwise studied or used to learn its design or composition without express written approval of BioLegend. Regardless of the information given in this document, user is solely responsible for determining any license requirements necessary for user’s intended use and assumes all risk and liability arising from use of the product. BioLegend is not responsible for patent infringement or any other risks or liabilities whatsoever resulting from the use of its products.

 

BioLegend, the BioLegend logo, and all other trademarks are property of BioLegend, Inc. or their respective owners, and all rights are reserved.

 

8999 BioLegend Way, San Diego, CA 92121 www.biolegend.com
Toll-Free Phone: 1-877-Bio-Legend (246-5343) Phone: (858) 768-5800 Fax: (877) 455-9587

This data display is provided for general comparisons between formats.
Your actual data may vary due to variations in samples, target cells, instruments and their settings, staining conditions, and other factors.
If you need assistance with selecting the best format contact our expert technical support team.

ProductsHere

Login/Register
Remember me
Forgot your password? Reset Password
Request an Account