- Clone
- IA6-2 (See other available formats)
- Regulatory Status
- RUO
- Other Names
- Ig delta chain C region
- Isotype
- Mouse IgG2a, κ
- Barcode Sequence
- CAGTCTCCGTAGAGT
- Ave. Rating
- Submit a Review
- Product Citations
- publications
Cat # | Size | Price | Quantity Check Availability | Save | ||
---|---|---|---|---|---|---|
348251 | 10 µg | $358 |
IgD, a member of the immunoglobulin (Ig) family, is expressed in naïve B cells. It has 3 Ig-like domains and exists in a transmembrane and a soluble form. In general, IgD is not secreted and usually its expression is lost after the Ig isotype switch. After antigen binding, IgD signals through the CD79a/CD79b (Igα/Igβ) heterodimer, resulting in the activation of the B cell.
Product DetailsProduct Details
- Verified Reactivity
- Human
- Antibody Type
- Monoclonal
- Host Species
- Mouse
- Immunogen
- Human IgD
- Formulation
- Phosphate-buffered solution, pH 7.2, containing 0.09% sodium azide and EDTA
- Preparation
- The antibody was purified by chromatography and conjugated with TotalSeq™-D oligomer under optimal conditions.
- Concentration
- 0.5 mg/mL
- Storage & Handling
- The antibody solution should be stored undiluted between 2°C and 8°C. Do not freeze.
- Application
-
PG - Quality tested
- Recommended Usage
-
Each lot of this antibody is quality control tested by immunofluorescent staining with flow cytometric analysis and the oligomer sequence is confirmed by sequencing. TotalSeq™-D antibodies are compatible with Mission Bio’s Tapestri Single-Cell Sequencing Platform for simultaneous detection of DNA and Protein.
To maximize performance, it is strongly recommended that the reagent be titrated for each application, and that you centrifuge the antibody dilution before adding to the cells at 14,000xg at 2 - 8°C for 10 minutes. Carefully pipette out the liquid avoiding the bottom of the tube and add to the cell suspension. For Proteogenomics analysis, the suggested starting amount of this reagent for titration is ≤ 1.0 µg per million cells in 100 µL volume. Refer to the corresponding TotalSeq™ protocol for specific staining instructions.
Buyer is solely responsible for determining whether Buyer has all intellectual property rights that are necessary for Buyer's intended uses of the BioLegend TotalSeq™ products. For example, for any technology platform Buyer uses with TotalSeq™, it is Buyer's sole responsibility to determine whether it has all necessary third party intellectual property rights to use that platform and TotalSeq™ with that platform. - Application Notes
-
Additional reported applications (for the relevant formats) include: immunohistochemical staining of paraformaldehyde fixed frozen sections4 and spatial biology (IBEX)5,6.
- Additional Product Notes
-
TotalSeq™-D reagents are designed to profile protein expression at single cell level. The Mission Bio Tapestri platform and sequencer (e.g. Illumina analyzers) are required. Please contact technical support for more information, or visit biolegend.com/totalseq/single-cell-dna
The barcode flanking sequences are CGAGATGACTACGCTACTCATGG (PCR handle), and GAGCCGATCTAGTATCTCAGT*C*G (capture sequence). * indicates a phosphorothioated bond, to prevent nuclease degradation.
View more applications data for this product in our Application Technical Notes. -
Application References
(PubMed link indicates BioLegend citation) -
- Chen K, et al. 2009. Nat. Immunol. 10:889.
- Lee CH, et al. 2005. J. Exp. Med. 203:63.
- Sutter JA, et al. 2008. Clin. Immunol. 126:282.
- Li H and Pauza CD. 2015. Eur. J. Immunol. 45:298. (IHC)
- Radtke AJ, et al. 2020. Proc Natl Acad Sci USA. 117:33455-33465. (SB) PubMed
- Radtke AJ, et al. 2022. Nat Protoc. 17:378-401. (SB) PubMed
- RRID
-
AB_2924547 (BioLegend Cat. No. 348251)
Antigen Details
- Structure
- Exists in a transmembranal and a soluble form
- Distribution
-
Naïve B cells
- Function
- Antigen binding, B cell activation
- Interaction
- The CD79a/CD79b heterodimer
- Cell Type
- B cells
- Biology Area
- Immunology
- Antigen References
-
1. Geisberger R, et al. 2006. Immunology 118:429.
2. Weller S, et al. 2005. Eur. J. Immunol. 35:2789.
3. Brandtzaeg P and Johansen FE. 2005. Immunol. Rev. 206:32. - Gene ID
- 3495 View all products for this Gene ID
- UniProt
- View information about IgD on UniProt.org
Related FAQs
Other Formats
View All IgD Reagents Request Custom ConjugationCompare Data Across All Formats
This data display is provided for general comparisons between formats.
Your actual data may vary due to variations in samples, target cells, instruments and their settings, staining conditions, and other factors.
If you need assistance with selecting the best format contact our expert technical support team.
-
Alexa Fluor® 647 anti-human IgD
-
PerCP anti-human IgD
-
Brilliant Violet 605™ anti-human IgD
-
Alexa Fluor® 700 anti-human IgD
-
Purified anti-human IgD
-
PE anti-human IgD
-
Biotin anti-human IgD
-
FITC anti-human IgD
-
PerCP/Cyanine5.5 anti-human IgD
-
PE/Cyanine7 anti-human IgD
-
Alexa Fluor® 488 anti-human IgD
-
APC/Cyanine7 anti-human IgD
-
Brilliant Violet 510™ anti-human IgD
-
APC anti-human IgD
-
Pacific Blue™ anti-human IgD
-
Brilliant Violet 421™ anti-human IgD
-
Purified anti-human IgD (Maxpar® Ready)
-
PE/Dazzle™ 594 anti-human IgD
-
APC/Fire™ 750 anti-human IgD
-
Brilliant Violet 785™ anti-human IgD
-
TotalSeq™-A0384 anti-human IgD
-
TotalSeq™-C0384 anti-human IgD
-
TotalSeq™-B0384 anti-human IgD
-
PE/Cyanine5 anti-human IgD
-
TotalSeq™-D0384 anti-human IgD
-
Spark UV™ 387 anti-human IgD
-
PE anti-human IgD
Follow Us